ID: 1154954428

View in Genome Browser
Species Human (GRCh38)
Location 18:21241536-21241558
Sequence GACGAGCCGGGGCCCGGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154954410_1154954428 16 Left 1154954410 18:21241497-21241519 CCTGGGGTGGAGCCGTCCCCGTG No data
Right 1154954428 18:21241536-21241558 GACGAGCCGGGGCCCGGGGCCGG No data
1154954420_1154954428 -10 Left 1154954420 18:21241523-21241545 CCGGGAGGCTACCGACGAGCCGG No data
Right 1154954428 18:21241536-21241558 GACGAGCCGGGGCCCGGGGCCGG No data
1154954409_1154954428 17 Left 1154954409 18:21241496-21241518 CCCTGGGGTGGAGCCGTCCCCGT No data
Right 1154954428 18:21241536-21241558 GACGAGCCGGGGCCCGGGGCCGG No data
1154954415_1154954428 4 Left 1154954415 18:21241509-21241531 CCGTCCCCGTGGTCCCGGGAGGC No data
Right 1154954428 18:21241536-21241558 GACGAGCCGGGGCCCGGGGCCGG No data
1154954417_1154954428 -1 Left 1154954417 18:21241514-21241536 CCCGTGGTCCCGGGAGGCTACCG No data
Right 1154954428 18:21241536-21241558 GACGAGCCGGGGCCCGGGGCCGG No data
1154954419_1154954428 -9 Left 1154954419 18:21241522-21241544 CCCGGGAGGCTACCGACGAGCCG No data
Right 1154954428 18:21241536-21241558 GACGAGCCGGGGCCCGGGGCCGG No data
1154954418_1154954428 -2 Left 1154954418 18:21241515-21241537 CCGTGGTCCCGGGAGGCTACCGA No data
Right 1154954428 18:21241536-21241558 GACGAGCCGGGGCCCGGGGCCGG No data
1154954416_1154954428 0 Left 1154954416 18:21241513-21241535 CCCCGTGGTCCCGGGAGGCTACC No data
Right 1154954428 18:21241536-21241558 GACGAGCCGGGGCCCGGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154954428 Original CRISPR GACGAGCCGGGGCCCGGGGC CGG Intergenic
No off target data available for this crispr