ID: 1154954430

View in Genome Browser
Species Human (GRCh38)
Location 18:21241540-21241562
Sequence AGCCGGGGCCCGGGGCCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154954420_1154954430 -6 Left 1154954420 18:21241523-21241545 CCGGGAGGCTACCGACGAGCCGG No data
Right 1154954430 18:21241540-21241562 AGCCGGGGCCCGGGGCCGGAGGG No data
1154954416_1154954430 4 Left 1154954416 18:21241513-21241535 CCCCGTGGTCCCGGGAGGCTACC No data
Right 1154954430 18:21241540-21241562 AGCCGGGGCCCGGGGCCGGAGGG No data
1154954418_1154954430 2 Left 1154954418 18:21241515-21241537 CCGTGGTCCCGGGAGGCTACCGA No data
Right 1154954430 18:21241540-21241562 AGCCGGGGCCCGGGGCCGGAGGG No data
1154954419_1154954430 -5 Left 1154954419 18:21241522-21241544 CCCGGGAGGCTACCGACGAGCCG No data
Right 1154954430 18:21241540-21241562 AGCCGGGGCCCGGGGCCGGAGGG No data
1154954409_1154954430 21 Left 1154954409 18:21241496-21241518 CCCTGGGGTGGAGCCGTCCCCGT No data
Right 1154954430 18:21241540-21241562 AGCCGGGGCCCGGGGCCGGAGGG No data
1154954410_1154954430 20 Left 1154954410 18:21241497-21241519 CCTGGGGTGGAGCCGTCCCCGTG No data
Right 1154954430 18:21241540-21241562 AGCCGGGGCCCGGGGCCGGAGGG No data
1154954415_1154954430 8 Left 1154954415 18:21241509-21241531 CCGTCCCCGTGGTCCCGGGAGGC No data
Right 1154954430 18:21241540-21241562 AGCCGGGGCCCGGGGCCGGAGGG No data
1154954417_1154954430 3 Left 1154954417 18:21241514-21241536 CCCGTGGTCCCGGGAGGCTACCG No data
Right 1154954430 18:21241540-21241562 AGCCGGGGCCCGGGGCCGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154954430 Original CRISPR AGCCGGGGCCCGGGGCCGGA GGG Intergenic
No off target data available for this crispr