ID: 1154954437

View in Genome Browser
Species Human (GRCh38)
Location 18:21241557-21241579
Sequence GGAGGGCGTGCTCCTCCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154954431_1154954437 -8 Left 1154954431 18:21241542-21241564 CCGGGGCCCGGGGCCGGAGGGCG No data
Right 1154954437 18:21241557-21241579 GGAGGGCGTGCTCCTCCGGGAGG No data
1154954418_1154954437 19 Left 1154954418 18:21241515-21241537 CCGTGGTCCCGGGAGGCTACCGA No data
Right 1154954437 18:21241557-21241579 GGAGGGCGTGCTCCTCCGGGAGG No data
1154954420_1154954437 11 Left 1154954420 18:21241523-21241545 CCGGGAGGCTACCGACGAGCCGG No data
Right 1154954437 18:21241557-21241579 GGAGGGCGTGCTCCTCCGGGAGG No data
1154954427_1154954437 0 Left 1154954427 18:21241534-21241556 CCGACGAGCCGGGGCCCGGGGCC No data
Right 1154954437 18:21241557-21241579 GGAGGGCGTGCTCCTCCGGGAGG No data
1154954416_1154954437 21 Left 1154954416 18:21241513-21241535 CCCCGTGGTCCCGGGAGGCTACC No data
Right 1154954437 18:21241557-21241579 GGAGGGCGTGCTCCTCCGGGAGG No data
1154954417_1154954437 20 Left 1154954417 18:21241514-21241536 CCCGTGGTCCCGGGAGGCTACCG No data
Right 1154954437 18:21241557-21241579 GGAGGGCGTGCTCCTCCGGGAGG No data
1154954415_1154954437 25 Left 1154954415 18:21241509-21241531 CCGTCCCCGTGGTCCCGGGAGGC No data
Right 1154954437 18:21241557-21241579 GGAGGGCGTGCTCCTCCGGGAGG No data
1154954419_1154954437 12 Left 1154954419 18:21241522-21241544 CCCGGGAGGCTACCGACGAGCCG No data
Right 1154954437 18:21241557-21241579 GGAGGGCGTGCTCCTCCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154954437 Original CRISPR GGAGGGCGTGCTCCTCCGGG AGG Intergenic
No off target data available for this crispr