ID: 1154956070

View in Genome Browser
Species Human (GRCh38)
Location 18:21256503-21256525
Sequence TAGTTGTTTTCACATCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154956070_1154956073 6 Left 1154956070 18:21256503-21256525 CCAGGGTGATGTGAAAACAACTA 0: 1
1: 0
2: 0
3: 10
4: 170
Right 1154956073 18:21256532-21256554 CTGGTAGGCTCATTACCTTTTGG 0: 1
1: 0
2: 2
3: 7
4: 82
1154956070_1154956072 -9 Left 1154956070 18:21256503-21256525 CCAGGGTGATGTGAAAACAACTA 0: 1
1: 0
2: 0
3: 10
4: 170
Right 1154956072 18:21256517-21256539 AAACAACTACATTCTCTGGTAGG 0: 1
1: 0
2: 0
3: 13
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154956070 Original CRISPR TAGTTGTTTTCACATCACCC TGG (reversed) Intronic
900439179 1:2644860-2644882 AAGTGGTTTCCACATCACCAGGG + Intronic
905661784 1:39732868-39732890 CAGCTGTTTCCACATCACCTGGG + Intronic
905785528 1:40753935-40753957 TAGTTGTTTTTTCAGCACCTTGG + Intronic
908481259 1:64541807-64541829 TTTTTGTTTTCTTATCACCCAGG - Intronic
910007098 1:82411132-82411154 TTGTTGTTTATATATCACCCAGG + Intergenic
910090866 1:83462614-83462636 TTGTTGTTTTTACTTCATCCCGG + Intergenic
916465492 1:165070708-165070730 TAGTTTTTTTCAAAACAACCAGG + Intergenic
916618850 1:166473536-166473558 TAGTGCTTTTAACAACACCCAGG + Intergenic
917235386 1:172886300-172886322 TTCTTGTTTGCACATCGCCCAGG + Intergenic
918696032 1:187547604-187547626 TTTTTGTTTTCAAATCAGCCTGG + Intergenic
919151608 1:193707926-193707948 CAGTGGTTTTCAAATCACCCCGG - Intergenic
920510982 1:206551841-206551863 TAGTTGTTCACATCTCACCCTGG + Intronic
923458518 1:234187177-234187199 TTGTTCCTTTCACATCACCTGGG - Intronic
924201231 1:241661068-241661090 GAGTTGTTTTCTGATCACCATGG + Intronic
924482296 1:244447783-244447805 TAATTGTTTTAACATCTCTCTGG - Intronic
1062828636 10:590039-590061 GAGTGGTTTCCACATCACACAGG + Intronic
1064456508 10:15492240-15492262 TACTTGTTTTTACACCGCCCTGG - Intergenic
1066481039 10:35795635-35795657 GAGTTTTGTTCACATCACCATGG + Intergenic
1066605204 10:37159719-37159741 TTGTTTTTTTGAGATCACCCAGG + Intronic
1066605922 10:37170824-37170846 TTGTTTTTTTGAGATCACCCAGG + Intronic
1066606705 10:37182616-37182638 TTGTTTTTTTGAGATCACCCAGG + Intronic
1067210722 10:44258735-44258757 TAATTGTTTTCTCCTCAGCCAGG + Intergenic
1068018748 10:51552728-51552750 TACTTGATTTCACAACAGCCTGG - Intronic
1068107450 10:52636877-52636899 TAGAGGTTATTACATCACCCAGG - Intergenic
1069474737 10:68722043-68722065 TATTGGTTTTAACATTACCCTGG + Intronic
1071801075 10:89061019-89061041 TTTTTATTTTCACATCACACAGG + Intergenic
1072260255 10:93663320-93663342 TAGTGGTTTTCAGGTCCCCCTGG + Intronic
1073185478 10:101612976-101612998 TACTTGTTTTAACATCTCCTGGG - Intronic
1074266464 10:111909218-111909240 TTGCTGTTTTCAGATCACCTTGG - Intergenic
1075100828 10:119505003-119505025 TTGTTGATTTCACCTCACCCCGG + Intronic
1075881228 10:125853004-125853026 TAGTTTTGTTCAAATCAACCAGG + Intronic
1075899978 10:126033769-126033791 TAGTGGATTTCTCATCACCATGG + Intronic
1079087179 11:17454792-17454814 TAGTGTTTTTGACATCACTCAGG - Intronic
1079715499 11:23738505-23738527 TATTTGTTTTCAATTTACCCTGG + Intergenic
1080637956 11:34140110-34140132 TAGTTGTGTTCCCCTAACCCTGG + Intronic
1084649599 11:70481159-70481181 AGGGTGTTTTCAGATCACCCTGG + Intronic
1086291643 11:85317184-85317206 TAGTTGTTGTCACGCCACACTGG - Intronic
1087702738 11:101453903-101453925 AAGCAGTTTTCACATCACCTAGG + Intronic
1091854206 12:3725724-3725746 AATTTGTTTTCACATGATCCTGG + Intronic
1093368853 12:18340432-18340454 TAGTTGTTTTCAAAACATACTGG - Intronic
1096678627 12:53240412-53240434 CACTTTTTATCACATCACCCTGG + Intergenic
1105805421 13:23949329-23949351 TAGTTGTGTTCAACTCACCCAGG - Intergenic
1110404522 13:75134759-75134781 TAGTTGTTTTCAGTTCACAAAGG + Intergenic
1120805635 14:88746641-88746663 TAGGTGTTTTCTCATCCTCCAGG - Intronic
1121502997 14:94453361-94453383 TAATTGCATTCACATCAGCCTGG - Intergenic
1121837941 14:97108678-97108700 TAGGTGTCTTCACATCACACAGG - Intergenic
1123493826 15:20803202-20803224 TACTTGTTTTCACAGCTCCTCGG - Intergenic
1123550324 15:21372284-21372306 TACTTGTTTTCACAGCTCCTCGG - Intergenic
1126245790 15:46503563-46503585 TTATTATTTTCACATCACTCTGG - Intergenic
1126398811 15:48248014-48248036 TAGCTGTTTCCATATCACCTGGG - Intronic
1126678900 15:51185348-51185370 TTCTTGTTTTCATATCAGCCTGG + Intergenic
1126918597 15:53494595-53494617 TAGAACTTTTCACCTCACCCTGG + Intergenic
1128542135 15:68543547-68543569 TAGTTATTCTCACAAGACCCTGG - Intergenic
1128570667 15:68730908-68730930 TGGTTGTTCTCACCCCACCCAGG + Intergenic
1129575404 15:76738163-76738185 GACTGGGTTTCACATCACCCAGG + Intronic
1202958667 15_KI270727v1_random:99538-99560 TACTTGTTTTCACAGCTCCTCGG - Intergenic
1138002984 16:53301369-53301391 TAATTTTTTTCACAGCACTCAGG + Intronic
1139542195 16:67626512-67626534 TTTGTGTTTTCACATTACCCTGG + Intronic
1139775523 16:69314644-69314666 GAGTTCATTTCACATCAGCCTGG + Intronic
1141249487 16:82342290-82342312 CAGTGTTTTTCAAATCACCCAGG + Intergenic
1142051537 16:87961543-87961565 TAGTTGTTTTCAATTAAGCCGGG + Intronic
1146059105 17:29595262-29595284 TAGCGCTTTGCACATCACCCTGG - Intronic
1146091478 17:29883099-29883121 TATTTCTTTTCACATCAGACAGG - Intronic
1149769942 17:59312674-59312696 TAGTTCTCATTACATCACCCAGG + Intergenic
1154307625 18:13242049-13242071 TGGCTGGCTTCACATCACCCTGG - Intronic
1154451349 18:14477662-14477684 TACTTGTTTTCACAGCTCCTTGG - Intergenic
1154956070 18:21256503-21256525 TAGTTGTTTTCACATCACCCTGG - Intronic
1155382037 18:25233766-25233788 GAGTTGTTATCACATCTCCATGG + Intronic
1156190277 18:34711212-34711234 GCGTTGTTTACATATCACCCTGG + Intronic
1156940230 18:42758537-42758559 GAGTTTTTCTCTCATCACCCAGG + Intronic
1159605255 18:70468275-70468297 CAGTAGTTTTCACAGCCCCCAGG - Intergenic
1161707504 19:5829068-5829090 TAGTGGCTTTCAGCTCACCCTGG - Intergenic
1163057604 19:14732762-14732784 TAGCTGTTTTCATATCACAATGG + Exonic
1163870827 19:19820182-19820204 TAATTATTTTCACATCCCACAGG - Intronic
1163919457 19:20275208-20275230 TAATTATTTTCACATCCCACAGG - Intergenic
1163969390 19:20777525-20777547 TAATTATTTTCACATCCCACAGG + Intronic
930672191 2:54163039-54163061 CAGTGCTTTTCAAATCACCCAGG + Intronic
933295225 2:80482479-80482501 TAGTTGCTTTCACATTACAATGG - Intronic
937640343 2:124204453-124204475 CAGTTGCTTTCACATCATTCTGG + Intronic
941273071 2:163454731-163454753 TAGTAGTCTACAGATCACCCAGG + Intergenic
942375153 2:175329003-175329025 AAGCTCTTTTCACATCACCCAGG - Intergenic
942924858 2:181419438-181419460 AAGTTGTTTTCCCAGCATCCAGG - Intergenic
943768525 2:191689877-191689899 TCGTTGTCTTCACATCACGCTGG - Intronic
944315683 2:198283484-198283506 TAGTAGCTTCCACATCACCTGGG - Intronic
944342424 2:198618027-198618049 TAGTTGGTTTAACATCAAGCAGG - Intergenic
946919828 2:224567429-224567451 TAGAAGTTTTAACACCACCCTGG - Intronic
948987918 2:241536620-241536642 TCATTATTTTCACATCACTCTGG + Intergenic
1169228884 20:3873772-3873794 TTGTTGTTTACAAATTACCCAGG + Exonic
1170270433 20:14521699-14521721 TTTTTGTTTTCACTTCACCATGG + Intronic
1171857288 20:30358752-30358774 GAGATGGTTTCAAATCACCCAGG + Intergenic
1175148378 20:56913556-56913578 TAACTGATTTCATATCACCCTGG + Intergenic
1176176446 20:63728507-63728529 TCTTTGCTTTCACTTCACCCTGG + Intronic
1176444794 21:6812565-6812587 TACTTGTTTTCACAGCTCCTTGG + Intergenic
1176740421 21:10596525-10596547 CATTTTTTTTCTCATCACCCTGG + Intronic
1176822960 21:13677600-13677622 TACTTGTTTTCACAGCTCCTTGG + Intergenic
1180391128 22:12283208-12283230 GAGATGGTTTCAAATCACCCAGG - Intergenic
1180408612 22:12581545-12581567 GAGATGGTTTCAAATCACCCAGG + Intergenic
1183544005 22:38446093-38446115 CAGTTGCTTACACATCTCCCAGG + Intronic
1183796968 22:40127204-40127226 GAGTTGTTTTCAGAGCTCCCAGG - Intronic
1183993275 22:41613420-41613442 TAGTTGTTCTCATAGTACCCTGG + Intronic
950319366 3:12035899-12035921 TAGTTGTTTTCAAAAAAACCTGG - Intronic
952995509 3:38877859-38877881 TAGTGGCTTTCACAGCAACCTGG + Intronic
954535897 3:51359017-51359039 AAGTTCTCTTCTCATCACCCAGG + Intronic
955566837 3:60256415-60256437 TTGTTGTTTCTAAATCACCCAGG + Intronic
959526398 3:107381987-107382009 TAGTTTTCTTCCCATCACTCTGG + Intergenic
960908293 3:122623249-122623271 TTGTTTTGTTCCCATCACCCAGG + Intronic
961071779 3:123936754-123936776 TACATGTTATTACATCACCCAGG - Intronic
963772581 3:149403579-149403601 TAGTTATTTTCATGTTACCCAGG - Intergenic
966218323 3:177525593-177525615 AAGTTGTGTTCAGAGCACCCTGG + Intergenic
967666568 3:192179804-192179826 TGGTTGTATTCCCAGCACCCCGG - Intronic
970084540 4:12332005-12332027 TAGTTTTTTTCACACCAAGCAGG - Intergenic
970545416 4:17124940-17124962 TAGGCGTTATCACATCCCCCTGG + Intergenic
973685420 4:53365323-53365345 TAGTGGAGTCCACATCACCCAGG + Exonic
975234829 4:71981257-71981279 TAGTTGTTTTCACGGTACCAGGG - Intergenic
976329101 4:83808000-83808022 TAGTTTTTTTCACATATCACTGG + Intergenic
978331990 4:107623504-107623526 TGTTTGTTTTAATATCACCCAGG + Intronic
979046105 4:115867166-115867188 TAGATGTTTTCACTTAAACCTGG - Intergenic
984667122 4:182440909-182440931 TAGATATTATCCCATCACCCAGG + Intronic
985114771 4:186579755-186579777 TAGTTATAATCATATCACCCAGG - Intergenic
985434300 4:189914113-189914135 GAGATGGTTTCACATCACCCAGG + Intergenic
990161621 5:52946620-52946642 TAATTTTTTTCAAATCCCCCAGG + Intronic
991299159 5:65112231-65112253 TAGTTGTTTTGACCTCTCTCAGG - Intergenic
992688049 5:79217092-79217114 TAGTTGATTCCACTACACCCGGG - Intronic
993357318 5:86930366-86930388 TAGGTGTTGTCTGATCACCCTGG - Intergenic
995646166 5:114314737-114314759 TAGTTGTTTAGAGATAACCCAGG + Intergenic
996195150 5:120596318-120596340 CAGATGTTTTAACTTCACCCTGG - Intronic
999070397 5:148738132-148738154 TAGATGTTTTCATCTCAACCTGG + Intergenic
999390024 5:151183013-151183035 TAGGTGTTTCCACTCCACCCTGG - Exonic
999820386 5:155222108-155222130 TTGTTATTTTCACATCAAACTGG - Intergenic
999988700 5:157029150-157029172 TAGCTGTTTTCTCATAACTCTGG - Intergenic
1000259954 5:159578246-159578268 TGGTTGTTTTCACACCATGCTGG + Intergenic
1006125419 6:31834833-31834855 TAGTTGTTTTCTTATCTGCCTGG - Exonic
1006777254 6:36604845-36604867 TAGTGGTTCTCACATCACCAAGG - Exonic
1007974971 6:46092054-46092076 GAGTTGTTATCACCTCACACCGG - Intergenic
1008842039 6:55914127-55914149 TGGTTGTTTTCATATAACCAAGG - Intergenic
1011360333 6:86517327-86517349 TATTTGTTTACACACCACTCTGG + Intergenic
1013370893 6:109470238-109470260 TACTTCTGTTGACATCACCCTGG - Intronic
1013838013 6:114355821-114355843 CTGATGGTTTCACATCACCCAGG - Intergenic
1014659970 6:124157488-124157510 AAGTTGTTTTCACATTGACCTGG + Intronic
1016671892 6:146718890-146718912 TAGGTGTTTTCACATACTCCAGG - Intronic
1017458572 6:154626261-154626283 TAGTTCTTACCACAGCACCCTGG + Intergenic
1017603604 6:156109934-156109956 TATTTGTATTCACAGCACCTAGG - Intergenic
1018498449 6:164376344-164376366 TGGCTCTTTTCACATCACCTTGG - Intergenic
1019775887 7:2912058-2912080 GAGTTGTTTTCACCTCCCCGTGG - Intronic
1021323942 7:19244168-19244190 CAGTTGTTTTCAAATCACCTTGG - Intergenic
1024272873 7:47655686-47655708 TAGTTGTTTTCCCAACATCTGGG + Intronic
1027307712 7:76919105-76919127 TTGTTGTTTTTACTTCATCCCGG + Intergenic
1028406528 7:90481141-90481163 TAGTGGTTTTTACAACTCCCAGG - Intronic
1028885082 7:95923112-95923134 TAGCTGTTCTCACACCAGCCAGG + Intronic
1029858914 7:103548153-103548175 TAATTTTATTCACATCACCTTGG - Intronic
1031110363 7:117600377-117600399 TAGTTGTTTTCAAAAGAACCAGG - Intronic
1033610794 7:142961654-142961676 TCCTTGTTTTCTCATCTCCCAGG - Intronic
1034216770 7:149413594-149413616 TACATATTATCACATCACCCAGG - Intergenic
1034409125 7:150929394-150929416 GAGTTATTTTGACATGACCCTGG - Intergenic
1036648741 8:10628532-10628554 TTGTTTTTTTCTCATCACCAAGG - Intronic
1042939875 8:74096817-74096839 GAGAAGTATTCACATCACCCTGG - Intergenic
1043295003 8:78651054-78651076 TAGATTTTTTTTCATCACCCAGG - Intergenic
1043478312 8:80626633-80626655 TGGTTGTTTTCAGGTTACCCAGG + Intergenic
1045502680 8:102755558-102755580 CAGTTGTTTTCAAAGCTCCCAGG - Intergenic
1046271932 8:111907627-111907649 TACTGGTTTTCAAATAACCCAGG + Intergenic
1046472509 8:114695091-114695113 TAGATGTTTTAACATCAGACAGG + Intergenic
1046514986 8:115247411-115247433 TAGGTGTTTTGTCATCACCCAGG + Intergenic
1047409139 8:124609955-124609977 CTGTTGTTTGCACATCACCAGGG - Intronic
1047912996 8:129551514-129551536 TGGTTGTGTGCACATCACCATGG - Intergenic
1048124084 8:131613474-131613496 TAGTTGTTTTAAAATAACTCTGG + Intergenic
1048730677 8:137437397-137437419 TATTGGTTTTCACATGATCCTGG + Intergenic
1050274341 9:3981232-3981254 TAGGTCTTTTCACTTCAACCAGG + Intronic
1050938752 9:11431682-11431704 TAATTATTTTCACATCTCACAGG + Intergenic
1052248697 9:26370599-26370621 TAGTTGTATCCCCAGCACCCAGG - Intergenic
1055776021 9:79767981-79768003 TTGATGTTTTCACTTCAACCTGG - Intergenic
1056601627 9:88051442-88051464 TTTTTGTTTTGACAGCACCCAGG - Intergenic
1057507301 9:95645910-95645932 TATTTGGTTTCACATCATTCTGG - Intergenic
1057957139 9:99419497-99419519 CAGTTGTTTTCAAAACATCCAGG - Intergenic
1058890309 9:109355515-109355537 TAGGTGCTTTCAGAGCACCCAGG + Intergenic
1059763159 9:117358536-117358558 CAATTGTCTTTACATCACCCTGG + Intronic
1060805174 9:126570877-126570899 GAGTAGCTTTCACAGCACCCTGG + Intergenic
1203524404 Un_GL000213v1:71962-71984 TACTTGTTTTCACAGCTCCTTGG - Intergenic
1188530014 X:31129593-31129615 TAGTTGCTTTCTCATTACCAGGG - Intronic
1188565728 X:31523944-31523966 TAGTTATTTTTAAATGACCCTGG + Intronic
1198372964 X:136009402-136009424 AAGTTCTTTTCATATCTCCCAGG - Intronic
1198513171 X:137374656-137374678 TAGTTGGGTTCACACCACCAAGG - Intergenic