ID: 1154957158

View in Genome Browser
Species Human (GRCh38)
Location 18:21270071-21270093
Sequence CTGTGTATGTACATGCATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 1, 2: 1, 3: 51, 4: 337}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154957150_1154957158 27 Left 1154957150 18:21270021-21270043 CCCCTAACCAGAGATAACTCCAT 0: 1
1: 0
2: 0
3: 13
4: 145
Right 1154957158 18:21270071-21270093 CTGTGTATGTACATGCATTTAGG 0: 1
1: 1
2: 1
3: 51
4: 337
1154957151_1154957158 26 Left 1154957151 18:21270022-21270044 CCCTAACCAGAGATAACTCCATT 0: 1
1: 0
2: 0
3: 11
4: 151
Right 1154957158 18:21270071-21270093 CTGTGTATGTACATGCATTTAGG 0: 1
1: 1
2: 1
3: 51
4: 337
1154957153_1154957158 20 Left 1154957153 18:21270028-21270050 CCAGAGATAACTCCATTTCTAGT 0: 1
1: 0
2: 0
3: 12
4: 162
Right 1154957158 18:21270071-21270093 CTGTGTATGTACATGCATTTAGG 0: 1
1: 1
2: 1
3: 51
4: 337
1154957155_1154957158 -6 Left 1154957155 18:21270054-21270076 CCCTTCCTGAGATAATTCTGTGT 0: 1
1: 0
2: 1
3: 21
4: 331
Right 1154957158 18:21270071-21270093 CTGTGTATGTACATGCATTTAGG 0: 1
1: 1
2: 1
3: 51
4: 337
1154957156_1154957158 -7 Left 1154957156 18:21270055-21270077 CCTTCCTGAGATAATTCTGTGTA 0: 1
1: 0
2: 2
3: 37
4: 407
Right 1154957158 18:21270071-21270093 CTGTGTATGTACATGCATTTAGG 0: 1
1: 1
2: 1
3: 51
4: 337
1154957154_1154957158 8 Left 1154957154 18:21270040-21270062 CCATTTCTAGTATACCCTTCCTG 0: 1
1: 0
2: 0
3: 18
4: 196
Right 1154957158 18:21270071-21270093 CTGTGTATGTACATGCATTTAGG 0: 1
1: 1
2: 1
3: 51
4: 337
1154957152_1154957158 25 Left 1154957152 18:21270023-21270045 CCTAACCAGAGATAACTCCATTT 0: 1
1: 0
2: 1
3: 21
4: 170
Right 1154957158 18:21270071-21270093 CTGTGTATGTACATGCATTTAGG 0: 1
1: 1
2: 1
3: 51
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154957158 Original CRISPR CTGTGTATGTACATGCATTT AGG Intronic
901377921 1:8853081-8853103 GGGTGTATGTATGTGCATTTGGG + Intergenic
903197120 1:21699032-21699054 CTGTGCATGTACATGCATTTGGG - Intronic
903952295 1:27003195-27003217 CTGTGAATGTGCATGCACTGTGG - Intergenic
905008472 1:34730193-34730215 CTGTGTATGCACATCTATTTGGG - Intronic
905254857 1:36673867-36673889 GTGTGCATGTGCATGCAATTTGG + Intergenic
906582423 1:46947071-46947093 CTGTCTTTGTAGATGGATTTTGG - Intergenic
906583193 1:46953242-46953264 CTGTCTTTGTAGATGCATTTTGG - Intergenic
906601184 1:47130806-47130828 CTGTCTTTGTAGATGCATTTTGG + Intergenic
907222049 1:52914354-52914376 CTGTGTGTGTGCATGCATGTTGG + Intronic
907602736 1:55787184-55787206 CTGTCTTTGTAGATGGATTTTGG + Intergenic
908145572 1:61237995-61238017 CTTTGTATGTACATGCTCTGTGG + Intronic
908677170 1:66618315-66618337 TTGTGTATATAGATGCATTAGGG - Intronic
909940636 1:81607678-81607700 CTATGTAACTATATGCATTTTGG + Intronic
912244766 1:107949723-107949745 CTGTGTGTGTACATGTACTTTGG - Intronic
912902350 1:113665590-113665612 GTGTGTATGTATATATATTTTGG + Intronic
912942100 1:114054128-114054150 GTGTGTATGTACATGTATGTAGG + Intergenic
913420657 1:118664363-118664385 CTGTGTTTGTTCTTGCATTCTGG - Intergenic
913426910 1:118742070-118742092 GTGTGTATGTATATGCATAACGG + Intergenic
913470587 1:119181966-119181988 CTGTCTTTGTAGATGGATTTTGG + Intergenic
914834749 1:151197888-151197910 CTGTGTATCTCCATGCCCTTTGG + Intergenic
915047011 1:153026270-153026292 GTGTGTATGTGTATGCATGTGGG + Intergenic
916408112 1:164517858-164517880 GTGTGAATGTACATCCATTGTGG - Intergenic
917148746 1:171922161-171922183 GTGTGCATGCACATGCACTTGGG + Intronic
917453076 1:175163310-175163332 TTATGTATCTTCATGCATTTGGG - Intronic
922974739 1:229774848-229774870 TTTTGCATTTACATGCATTTAGG + Intergenic
1063257249 10:4341925-4341947 TTATGTGTGTACATGCATGTGGG - Intergenic
1063275226 10:4558970-4558992 TTTTATATGTACATACATTTAGG + Intergenic
1063475682 10:6326824-6326846 CTGTGTATTTTCATTAATTTTGG - Intergenic
1063482380 10:6386910-6386932 CTGTGTATGTGCCTGTATGTGGG - Intergenic
1064294692 10:14067870-14067892 CTGTTTGTGTATATACATTTGGG - Intronic
1065090554 10:22229078-22229100 CTGTTGAAATACATGCATTTCGG + Intergenic
1067087831 10:43252209-43252231 CTGTGTATGCACACCCATGTGGG - Intronic
1067190497 10:44064037-44064059 CTGTGCATGTCCATGAATTATGG - Intergenic
1067715422 10:48686823-48686845 CTATTTTTGTACATGCATCTTGG + Intronic
1069207994 10:65717137-65717159 CTGTGTACCTACATTCAATTGGG - Intergenic
1069214986 10:65808704-65808726 CTATGCATGTAATTGCATTTTGG + Intergenic
1069592241 10:69649438-69649460 CAGTGTATGCACATTCCTTTGGG - Intergenic
1070380256 10:75874948-75874970 CTGTGTGTGCACATGCAGATAGG + Intronic
1071760221 10:88595156-88595178 CTATGTATGTTTTTGCATTTCGG + Intronic
1072785974 10:98282546-98282568 CTGTGTGTGTACATGTGTGTTGG + Intergenic
1073611919 10:104952703-104952725 GTCTGTGTGTGCATGCATTTAGG - Intronic
1074463453 10:113660188-113660210 ATGTATATGTACATGCATGTGGG - Intronic
1075175982 10:120161414-120161436 CTGTGCATGTATGTGCTTTTTGG + Intergenic
1076535849 10:131176583-131176605 CTGTGTGTGTGCATGTGTTTTGG - Intronic
1078086566 11:8236857-8236879 GTGTGTATGAGCATGCGTTTTGG + Intronic
1078383707 11:10868399-10868421 CTGTGGATTCACATGCAGTTGGG + Intergenic
1079162357 11:18006875-18006897 CTGTGTATGTTCATGTATTCTGG + Intronic
1079899253 11:26160957-26160979 CTGAGTCTGGACATGCATTCAGG - Intergenic
1079899473 11:26163873-26163895 CTGAGTCTGGACATGCATTCAGG + Intergenic
1079917475 11:26387710-26387732 CTTTTTATGCACATGTATTTTGG + Intronic
1083280456 11:61623809-61623831 CTGTGTGTGTACATTCTTCTTGG - Intergenic
1083739202 11:64699150-64699172 CTGTGTATGTGCGTGGATTATGG - Intronic
1085137368 11:74104500-74104522 ATGTGTATGTACATGTATGGGGG + Intronic
1087401350 11:97670348-97670370 CTGTGTGTGTGCATGTATGTAGG - Intergenic
1087435181 11:98107089-98107111 TTGTGTATGAATATACATTTAGG - Intergenic
1091519679 12:1225077-1225099 GTGTGTATATACATACATTTGGG + Intronic
1091683858 12:2547543-2547565 CTGTGTGTGTAAATGCGTGTGGG + Intronic
1091895071 12:4095854-4095876 CTGTATATGTATATCAATTTAGG - Intergenic
1094082225 12:26549873-26549895 CTGAGAATGTCTATGCATTTTGG - Intronic
1094212706 12:27909470-27909492 GTGTGCATGTGCATGCATGTTGG + Intergenic
1094631815 12:32183223-32183245 CTGTGTTTCTACAGGCTTTTAGG + Intronic
1097318582 12:58200766-58200788 CTGTGTCAAAACATGCATTTTGG - Intergenic
1099147584 12:79066041-79066063 TTGTGTATGTTCATGCATGTGGG - Intronic
1101473602 12:105022321-105022343 GTGTGTGTGCACATGAATTTTGG + Exonic
1103529303 12:121589438-121589460 CAGTCTATATGCATGCATTTTGG - Intergenic
1104060619 12:125264821-125264843 GTGTCTATGCACATGCGTTTGGG - Intronic
1104929608 12:132331263-132331285 CTGTGTATGCACATGTGTGTAGG + Intergenic
1105757327 13:23479413-23479435 CAGTTTCTGTTCATGCATTTTGG + Intergenic
1106602896 13:31202261-31202283 CCGTGTCTGTATATGCATGTGGG - Intronic
1106887891 13:34209621-34209643 CTGTTTATGTAAATGTATTAGGG + Intergenic
1108425854 13:50299430-50299452 ATGTGTGTGTACATGTATATGGG - Intronic
1108566677 13:51706377-51706399 TTGTGTATGAACATGCACTTGGG + Intronic
1109528607 13:63608794-63608816 CTGTGTATGTATATGTGTTTTGG + Intergenic
1109966362 13:69703010-69703032 CAGGGAAAGTACATGCATTTTGG - Intronic
1110022730 13:70495342-70495364 GTGTGTGTGCACATGCCTTTGGG - Intergenic
1110370360 13:74733094-74733116 GTGTGTATGTGCATGTGTTTAGG - Intergenic
1110394061 13:75009630-75009652 GGGTGTATGTGCATGCATGTGGG - Intergenic
1110683135 13:78339922-78339944 CTCTGTATGTGCATTCATTTGGG + Intergenic
1110688374 13:78402182-78402204 CTGTGTCTGTATTTGCACTTTGG + Intergenic
1110923696 13:81122803-81122825 ATGTGTATATACACACATTTTGG - Intergenic
1111316309 13:86565268-86565290 CTGTTTATATACATATATTTGGG + Intergenic
1111670215 13:91320616-91320638 CTGTGTATGAACCTGCACCTAGG + Intergenic
1112781773 13:102908513-102908535 ATGTATATGTAGATTCATTTAGG + Intergenic
1113873095 13:113575431-113575453 TTGTGTATGTACTTTCATATGGG - Intergenic
1114073482 14:19133198-19133220 CTGTGTGGCTAGATGCATTTCGG + Intergenic
1114088783 14:19266785-19266807 CTGTGTGGCTAGATGCATTTCGG - Intergenic
1114263917 14:21059964-21059986 CTCTGTATGTATATGCATATGGG - Intronic
1115153530 14:30313004-30313026 GTGTGTGTGTGCATGCATGTTGG - Intergenic
1115742141 14:36399592-36399614 CTTTGGATGTACCTGCATTTAGG - Intergenic
1117252660 14:53952297-53952319 ATGTGTCTGCATATGCATTTAGG + Intronic
1117287278 14:54298678-54298700 CCTTGAATGTGCATGCATTTAGG - Intergenic
1118107686 14:62678751-62678773 CTGTGTAACTACAAGTATTTTGG - Intergenic
1118629913 14:67693532-67693554 GTGTGTATGTGCATGCGTGTGGG - Intronic
1118658952 14:67986042-67986064 CTGTGTGTGTATGTGCATTTGGG + Intronic
1118826378 14:69386535-69386557 CTGTGTAAGTACGTATATTTTGG - Intronic
1119123578 14:72102303-72102325 TTGTTTATGTAAATGTATTTTGG - Intronic
1122130083 14:99599917-99599939 TTGTGTATGTACATGCAAATAGG - Intronic
1122195408 14:100081377-100081399 GTGTGTATTTTCTTGCATTTAGG + Intronic
1124645583 15:31435713-31435735 CTGTGCATACACATGCATGTGGG - Intergenic
1124869544 15:33527183-33527205 CTGTTTATGTACAACCCTTTAGG + Intronic
1125433017 15:39616424-39616446 CTGTGAATGTCCAAGCACTTTGG - Intronic
1127939265 15:63677274-63677296 CTGGGTATTTAAAAGCATTTAGG - Intronic
1128553140 15:68611126-68611148 CTCTATATGTACACGCATGTTGG + Intronic
1129196726 15:73972945-73972967 GTGTGTGTGTGAATGCATTTGGG + Intergenic
1129480997 15:75826186-75826208 CAGTGTATTTACTTGCATTCTGG + Intergenic
1130289500 15:82584699-82584721 CTGTGTAGATAGATGCATTATGG - Intronic
1130836082 15:87651452-87651474 CTCTGTATGTACACGTATGTGGG + Intergenic
1138242345 16:55437250-55437272 CTGTGTGAGTAAATGGATTTAGG + Intronic
1138447393 16:57073011-57073033 CTGTCCATGTACCTGCATCTCGG + Intronic
1138560195 16:57796735-57796757 GTGTGTGTGTGCATGCATATAGG - Intronic
1138918542 16:61498341-61498363 TTGTGTGTGTGCATGCATATGGG - Intergenic
1138959535 16:62012010-62012032 GTGTGTATGTGCATGCAGGTGGG + Intronic
1139606922 16:68025491-68025513 ATAGGTATGTATATGCATTTGGG + Exonic
1140722940 16:77787863-77787885 CTGTGTATGTGCATGCATGTTGG + Intergenic
1141075498 16:81003097-81003119 CTGTGTATGCACCAACATTTAGG - Intronic
1141357616 16:83363380-83363402 ATGTGTGTATACATGCATTGTGG + Intronic
1141783394 16:86180678-86180700 ATGTGTATATACATGCATGTGGG - Intergenic
1141783399 16:86180774-86180796 GTGTGTATATAAATGCATGTGGG - Intergenic
1141909849 16:87051219-87051241 GTGTGTGTGTACATGTATGTTGG + Intergenic
1145977974 17:28995328-28995350 CTGTGTGTGTGCATGTATGTGGG + Intronic
1146134963 17:30311585-30311607 CTGTATATGTACATATATGTGGG + Intergenic
1148686103 17:49502093-49502115 CTGTGTGTGTACAGGCCTGTGGG - Exonic
1149995036 17:61401835-61401857 GGGTGGATGTACATGCGTTTGGG - Exonic
1152028763 17:77828497-77828519 GTGTGCATGTATATGCATGTGGG + Intergenic
1152028767 17:77828564-77828586 GTGTGTATGTATATGCATGTGGG + Intergenic
1152028776 17:77828662-77828684 GTGTGCATGTATATGCATGTGGG + Intergenic
1152028782 17:77828778-77828800 GTGTGCATGTATATGCATGTGGG + Intergenic
1152028806 17:77829088-77829110 GTGTGCATGTATATGCATGTGGG + Intergenic
1152028811 17:77829202-77829224 GTGTGCATGTATATGCATGTGGG + Intergenic
1153656539 18:7287767-7287789 GTGTGCATGTATACGCATTTAGG - Intergenic
1154471942 18:14712147-14712169 TTATGTATGTAAATGTATTTTGG + Intergenic
1154957158 18:21270071-21270093 CTGTGTATGTACATGCATTTAGG + Intronic
1155690535 18:28616574-28616596 TTGTAAATGTACATGCATTTTGG - Intergenic
1157300488 18:46475330-46475352 GTGTGTGTGTACATGAATGTGGG - Intergenic
1158546262 18:58399903-58399925 CTGTGTATGAACCTGGCTTTCGG - Intronic
1159548307 18:69868760-69868782 ATGTGCATGTGCGTGCATTTGGG - Intronic
1159667968 18:71186660-71186682 CTCTGTATTTATATCCATTTTGG + Intergenic
1160344548 18:78122379-78122401 TTGTGTATATATATGAATTTTGG - Intergenic
1160699608 19:499509-499531 CTGTGTTTGTACACGCGTGTGGG - Intronic
1160999707 19:1904414-1904436 CTCTGTGTGTTCATGAATTTTGG - Intergenic
1162530406 19:11232773-11232795 CTGTGTAGGTATATGCATGTGGG + Intronic
1162530418 19:11232854-11232876 CTGTGTATGTATATGCATGGGGG + Intronic
1163561895 19:18024151-18024173 TTGTGTGTGTACATGCCTCTGGG - Intergenic
1163663785 19:18593804-18593826 GTGAGTATGTTCATTCATTTCGG + Intronic
1165174402 19:33916881-33916903 CTGTGTATATGCATGCCTCTGGG - Intergenic
1166290921 19:41862940-41862962 CTGTGTATCTACATGCACAAGGG + Intronic
1166738407 19:45099603-45099625 CCGTGCCTGTACATGCAGTTGGG + Intronic
925545931 2:5016370-5016392 GTGTGTATACACATGCTTTTAGG + Intergenic
925802060 2:7611114-7611136 CTGTGTGTGGGCATGCATGTGGG + Intergenic
926142823 2:10378424-10378446 CTGAGTATGTGTCTGCATTTAGG - Intronic
927045857 2:19277491-19277513 CAGTGTCTGTACATGTAGTTTGG - Intergenic
927234637 2:20859598-20859620 ATGTGTATGTGCACACATTTTGG + Intergenic
928544227 2:32314055-32314077 TGGTACATGTACATGCATTTCGG - Exonic
928585794 2:32756740-32756762 CTGGATATGTACATCCATTTTGG + Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
928986240 2:37185158-37185180 ATGTGTCTGTACATGATTTTTGG - Intronic
930713513 2:54571534-54571556 GTGTGTGTGTACATACAATTAGG - Intronic
932727251 2:74189988-74190010 TTGTGGATGAACATGGATTTTGG + Intergenic
932921823 2:75924609-75924631 CTGTGTATCTAAATGCAATGTGG - Intergenic
934578790 2:95421416-95421438 ATATGTATGTGCATGCATGTGGG - Intergenic
934600657 2:95655287-95655309 ATATGTATGTGCATGCATGTGGG + Intergenic
935120720 2:100181309-100181331 GTGTGTATGTACATGTGTTGGGG + Intergenic
935573652 2:104687715-104687737 CTGTGTATGTCTATGGTTTTGGG + Intergenic
935748551 2:106210557-106210579 CTGTCTTTGTAGATGGATTTTGG - Intergenic
935999992 2:108817745-108817767 CTCTGTATATACATTGATTTTGG + Intronic
936534025 2:113297411-113297433 ATATGTATGTGCATGCATGTGGG + Intergenic
937739132 2:125328355-125328377 CTGTGTCTGCACTTGCATTCAGG + Intergenic
938605825 2:132891601-132891623 CTGTGTGTGCATATGCATATGGG + Intronic
939004679 2:136772236-136772258 GTGTGTGTGTTCTTGCATTTTGG - Intronic
939014718 2:136888973-136888995 GTGTGTGTGTACATGTATTTAGG + Intronic
939370162 2:141288960-141288982 GTGTGTTTGTACATGTACTTTGG + Intronic
939493888 2:142906120-142906142 CTGTCTCTGTAGATGGATTTTGG + Intronic
939495981 2:142929093-142929115 TTATGTATGTACATTAATTTTGG - Intronic
939622809 2:144440976-144440998 CTGTTTGTTTACATGCAGTTTGG - Intronic
940216149 2:151305499-151305521 CTGGGCATGTAGATGCATGTTGG - Intergenic
940415922 2:153419651-153419673 ATGTGTGTGTGCATGTATTTAGG - Intergenic
940607569 2:155946544-155946566 GTGTGTTTGCACATGCATTCAGG - Intergenic
940927356 2:159379993-159380015 GTGTGTATGTATATGAGTTTAGG - Intronic
941101815 2:161305096-161305118 CTTTGTATATACATACATTTTGG + Intergenic
941351243 2:164439802-164439824 GTGTGTATGTACATGGCATTAGG - Intergenic
941482533 2:166034832-166034854 CTTTCCATGTACATGCATTGAGG + Intronic
942397452 2:175566827-175566849 ATGTGTGAATACATGCATTTTGG + Intergenic
942618528 2:177821435-177821457 CTAAGTATGTACAAGAATTTAGG - Intronic
942619037 2:177827854-177827876 CAGTTTATGTACATGCTATTGGG + Intronic
942751753 2:179296097-179296119 GTGTGTGTGTATTTGCATTTGGG + Intergenic
942795809 2:179817789-179817811 CTGTGTGTGTGCATGCATGTTGG + Intronic
943075762 2:183192117-183192139 CTTTGTATTTACATACATTGGGG + Intergenic
944509729 2:200452953-200452975 CTCTGTATATATTTGCATTTAGG - Intronic
945564415 2:211378807-211378829 CTGTTTGTGTACATGGACTTCGG - Exonic
945633487 2:212316267-212316289 GTGTGTGTGTACATGCATGTGGG - Intronic
946165326 2:217860052-217860074 CTGTGTCTGTGGAAGCATTTTGG - Intronic
946585866 2:221187058-221187080 ATGTATATGTTCCTGCATTTTGG + Intergenic
947689225 2:232119523-232119545 AAGTGTATGTACCTACATTTTGG + Intronic
1170958796 20:21006559-21006581 CTCTCTATATACATGCCTTTTGG - Intergenic
1173121876 20:40300267-40300289 CTGTGTCTGTTCTTGAATTTGGG - Intergenic
1173971262 20:47154204-47154226 CTCTCCATGTACATGCATTGAGG - Intronic
1174305107 20:49609505-49609527 CTGTGGATTTACATGGATTAAGG + Intergenic
1174927492 20:54776650-54776672 CTTCGTATTTCCATGCATTTCGG - Intergenic
1175783716 20:61699232-61699254 CGGTGGCTGTAAATGCATTTGGG + Intronic
1176802552 21:13445742-13445764 TTATGTATGTAAATGTATTTTGG - Intergenic
1180491924 22:15855551-15855573 CTGTGTGGCTAGATGCATTTCGG + Intergenic
1182008565 22:26981693-26981715 GTGTGTATGTGCGTGCAGTTAGG + Intergenic
1182829742 22:33295348-33295370 ATGTGTGTGTACATGCGTGTGGG + Intronic
1183708571 22:39489401-39489423 CTCTGTAAGTAGATGCATTTGGG + Exonic
1184577890 22:45388253-45388275 ATGTGTGTGTATATACATTTGGG + Intronic
949699592 3:6741379-6741401 CTATTTATGTATGTGCATTTTGG + Intergenic
950463958 3:13142338-13142360 CTGTGTCTGAGCATGCATCTGGG - Intergenic
950584814 3:13884661-13884683 ATGTGTATGTGTATACATTTTGG + Intergenic
951315395 3:21183924-21183946 TTGTGGATCCACATGCATTTAGG - Intergenic
952796136 3:37241155-37241177 CTGTGTTTGTACATATATGTGGG - Intergenic
952882782 3:37995476-37995498 GTGTACATGTACATACATTTGGG - Intronic
954077466 3:48191303-48191325 ATATTTGTGTACATGCATTTTGG - Intergenic
954583672 3:51717304-51717326 CTGTGTAAGTGCATGTATGTGGG - Intronic
959232936 3:103680486-103680508 TTGTGTGTGTGCATGCATTAAGG - Intergenic
960050556 3:113235119-113235141 CTGTTTGTTTACATGCCTTTTGG + Intronic
961137398 3:124524701-124524723 ATGTGTATGTATGTGCATATAGG + Intronic
961664009 3:128485351-128485373 CTCTGTATGTGCATGTGTTTGGG - Intronic
961666237 3:128494642-128494664 GTGTGTATGTGCATGTATCTAGG + Intergenic
964261610 3:154845308-154845330 CTCTGTATGCATGTGCATTTTGG - Intergenic
966369203 3:179230049-179230071 CTGTGTAGCTACCTTCATTTTGG + Exonic
966547725 3:181169822-181169844 ATGTGTGTGTGCATGCATATTGG - Intergenic
966999743 3:185322616-185322638 CTGTGTATCCAGATGCCTTTTGG + Intronic
967158519 3:186714995-186715017 CTGTGTGTGTGTATGCATATGGG - Intergenic
967532774 3:190568125-190568147 CCGTGTGTGTGCCTGCATTTTGG - Intronic
968233478 3:197017440-197017462 CTGTGTAGGTACCTGGAGTTGGG - Intronic
968518712 4:1025632-1025654 CTGTGCGTGTGCGTGCATTTGGG - Exonic
969335978 4:6510541-6510563 GTGTGCATGCACATGCATGTGGG - Intronic
969939746 4:10719517-10719539 GTGTGTATGCACACACATTTAGG - Intergenic
970692659 4:18637633-18637655 ATGTGTGTGTACATGTATCTTGG + Intergenic
971154902 4:24071207-24071229 GTGTGTTTGTGCATGCATGTGGG - Intergenic
971766021 4:30833111-30833133 TTGTGTGTGTGCATGCATGTGGG + Intronic
972204108 4:36750082-36750104 ATGTGTATATACATGCATATTGG - Intergenic
972413634 4:38817585-38817607 ATGTGTGTGTGCATGCACTTGGG - Intronic
973161747 4:47026766-47026788 CTGTATAATTAAATGCATTTAGG - Intronic
974304435 4:60115219-60115241 CAGTATATTTATATGCATTTTGG - Intergenic
974425362 4:61736189-61736211 GTATGTATGTACATACATATGGG + Intronic
974456101 4:62130872-62130894 CTGTGTATATACAAGCAGCTGGG + Intergenic
974693622 4:65335628-65335650 GTGTGTATTTTCATGCATTTTGG - Intronic
974881093 4:67757994-67758016 ATGTGTATGAAAATGTATTTGGG + Intergenic
976779120 4:88738755-88738777 CAATGGATGTACATGCCTTTTGG + Intronic
977139932 4:93356845-93356867 ATTTTTATGTACAAGCATTTTGG + Intronic
978058368 4:104303169-104303191 GTCTAGATGTACATGCATTTTGG - Intergenic
978209532 4:106119298-106119320 CAGTGTATGTAAAGGCTTTTGGG - Intronic
978637851 4:110831705-110831727 CTGTATGTTTACATGCATCTAGG - Intergenic
978693193 4:111541176-111541198 GTGTGTGTGTACAGGCAGTTGGG + Intergenic
979098940 4:116590187-116590209 TTGTGTATGTATATGTGTTTAGG - Intergenic
979122107 4:116916579-116916601 CTGTGTTTGTATATGTGTTTAGG + Intergenic
979406315 4:120314685-120314707 TTGTCTATGTGCATGAATTTTGG - Intergenic
979739789 4:124134807-124134829 GTGGGTACGTACATACATTTAGG - Intergenic
979991869 4:127384333-127384355 ATGTGTATGTATATGTATATAGG - Intergenic
980591334 4:134893294-134893316 CTATGTATACACATGCATTTGGG - Intergenic
982312930 4:154004417-154004439 CTTTCTATGTACAGGTATTTGGG + Intergenic
982322548 4:154094574-154094596 GTATGTGTGTACATGCTTTTAGG + Intergenic
984267022 4:177507586-177507608 CTGTGAATATAAATGCACTTAGG + Intergenic
984597312 4:181684550-181684572 GTGTGTATTTTAATGCATTTAGG - Intergenic
984638462 4:182139925-182139947 CTCTCAATGTGCATGCATTTTGG - Intergenic
985383859 4:189424735-189424757 ATGTGTGTGTACATGCATACAGG - Intergenic
985833786 5:2256220-2256242 CTCTGTATGTGCATGCATATGGG + Intergenic
985911686 5:2889011-2889033 GTGTGTATGTGCATGCCTTATGG + Intergenic
986359361 5:6961093-6961115 GTGTGTTTGTGCATGCGTTTGGG - Intergenic
987452975 5:18109088-18109110 CTGTATGTATACATGCATATGGG + Intergenic
987802630 5:22718811-22718833 CTGTGTATTGCCATGCATTGTGG + Intronic
987953626 5:24708108-24708130 GTGTGTATGTATATGTATTTAGG + Intergenic
989207082 5:38821620-38821642 ATGTGTATATACATGTATATAGG - Intergenic
989367508 5:40673383-40673405 GTGTGTATCTACATGTATATAGG + Intergenic
990331987 5:54736751-54736773 CTGTTTATGGACAAGAATTTGGG + Intergenic
990381087 5:55222552-55222574 CTGTGTATGTACAGGCTATCAGG - Intronic
991023988 5:62010044-62010066 CTTTGTAAGTACCTGCCTTTTGG + Intergenic
992145411 5:73842295-73842317 CTGTGAATGAACATGCACATAGG + Intronic
992690279 5:79235357-79235379 CTGTTTTTGTATATGCATTCTGG + Intronic
994872367 5:105368022-105368044 CTTTGGATGTACATCCATTGTGG - Intergenic
995026051 5:107424085-107424107 CTGTGTTTGTATCTGAATTTTGG + Intronic
995119669 5:108522330-108522352 CTTTGCATATACATGCAGTTGGG + Intergenic
995787706 5:115847925-115847947 CTGTGAACGTATAAGCATTTGGG - Intronic
996475722 5:123918382-123918404 ATATATATGTACATGCATTGTGG + Intergenic
996986867 5:129578425-129578447 GTGTATATATACATGCATATAGG - Intronic
997432488 5:133850251-133850273 CTGTGTGTGCACATGCAATCTGG - Intergenic
998328388 5:141302623-141302645 ATTTGTGTGTACATGCAGTTTGG - Exonic
998542769 5:142998497-142998519 CTGTGTTTGTAAATGTATGTTGG + Intronic
998744224 5:145238484-145238506 ATGTGTAAATAAATGCATTTAGG - Intergenic
999329297 5:150661842-150661864 GAGTGTGTCTACATGCATTTGGG - Intronic
999911000 5:156199060-156199082 GTGTGTATCTACATGTGTTTAGG - Intronic
999966356 5:156813977-156813999 CTGTGTTTTCACATGTATTTAGG - Intergenic
1001209035 5:169793196-169793218 CTGTGTAAGCATATGCATTTTGG - Intronic
1001807299 5:174598320-174598342 TTATGTATATACATACATTTTGG + Intergenic
1002056874 5:176603223-176603245 CTGTGTGTGTACATGTTTTGGGG - Intronic
1002952009 6:1823448-1823470 CTGTGTAAGAACATACAATTGGG - Intronic
1003023617 6:2533496-2533518 CTGTGGTTCTATATGCATTTTGG - Intergenic
1003207942 6:4030669-4030691 CTGTTAATGTAAATGTATTTTGG + Intronic
1004300301 6:14451684-14451706 CTGTGAACGAACATGCAATTGGG + Intergenic
1005531939 6:26716440-26716462 CTGTGTCCTTATATGCATTTGGG - Intergenic
1005538856 6:26785225-26785247 CTGTGTCCTTATATGCATTTGGG + Intergenic
1005725667 6:28645307-28645329 CTGTGTGTATACATGTATATAGG + Intergenic
1007122219 6:39391967-39391989 GTGTGTGTATACATGTATTTTGG + Intronic
1007706940 6:43796944-43796966 GTGTGTGTGTACATGCGTTCTGG + Intergenic
1009009703 6:57827452-57827474 CTGTGTCCTTATATGCATTTGGG + Intergenic
1009873202 6:69473649-69473671 ATGTGTATGTAGATGCAGCTAGG - Intergenic
1010229988 6:73525698-73525720 CAGTGTTTCTACATGCTTTTTGG + Intergenic
1011379489 6:86727211-86727233 GTATGTATGTGCATGTATTTAGG + Intergenic
1012333371 6:98022194-98022216 GTGTGTATGTATGTGTATTTAGG - Intergenic
1012509695 6:99989002-99989024 ATGACTATGTACATGCATGTGGG - Intronic
1012541827 6:100370008-100370030 CTGTGTATGTATATACTGTTTGG - Intergenic
1013057865 6:106602229-106602251 CTGTGATTCCACATGCATTTTGG + Intronic
1013952398 6:115798978-115799000 CTGTGTATTTTCCTGCTTTTTGG - Intergenic
1014347818 6:120297045-120297067 TTGATTATGTACATACATTTTGG + Intergenic
1014854362 6:126381380-126381402 AAGTGTATATGCATGCATTTGGG - Intergenic
1016264718 6:142218952-142218974 CTTTGTATTTACATACATTAGGG + Exonic
1016319831 6:142830844-142830866 GTGTGGATGTGCATGCATTCTGG - Intronic
1016453603 6:144209391-144209413 CTGTGTACGTTCATGCAAGTGGG + Intergenic
1016547717 6:145243106-145243128 AGGTGTATGTTCATGCAGTTTGG - Intergenic
1017971677 6:159317097-159317119 ATGTGTATGTAGATGCTGTTGGG + Intergenic
1018412435 6:163565022-163565044 CTGTGTGTGTGCATGCACTCAGG + Intronic
1018765586 6:166930454-166930476 GTGTGTGTGTACATGCATGTGGG - Intronic
1018765590 6:166930541-166930563 CTCTGTGTGAACATGCATGTGGG - Intronic
1018765597 6:166930793-166930815 ATGTGTGTGTACATGCATGTGGG - Intronic
1018765599 6:166930832-166930854 ATGTGTGTGTACATGCATGTGGG - Intronic
1018854360 6:167664912-167664934 ATGTGTGTGCACATGCATGTGGG + Intergenic
1019214092 6:170431342-170431364 TTGTGTATGTATATACCTTTAGG - Intergenic
1019934992 7:4249048-4249070 CTGTGTATGTGTTTGTATTTAGG - Intronic
1020020529 7:4864371-4864393 CAGTGAATGTACATGCAGTGAGG - Intronic
1021485828 7:21167436-21167458 CAGTTTATGTACCTGCATTTTGG - Intergenic
1023630975 7:42164073-42164095 CTGTGTTTTTGCATGCATTTTGG - Intronic
1023847223 7:44129213-44129235 CTGTGTGTGTATGTGCATGTGGG - Intergenic
1025735679 7:64144656-64144678 CTGTGAATGGACATGCAGTCAGG - Intronic
1026445390 7:70480214-70480236 GTGTGTGTGCACATGCACTTAGG + Intronic
1026567071 7:71497997-71498019 ATGTGTATGCACATGCGTGTGGG + Intronic
1030545570 7:110890964-110890986 GTGTGTGTGTATATGTATTTGGG - Intronic
1031194397 7:118593566-118593588 GTGTGTATGTGCATGCATGTTGG - Intergenic
1031194899 7:118600877-118600899 GTGTGTATATACATGCATGTGGG - Intergenic
1031277536 7:119748371-119748393 CTGTGAATGTGCATGCAAATAGG + Intergenic
1032632142 7:133664942-133664964 TTTTGTAAGTACATGCATTTTGG + Intronic
1032725532 7:134587052-134587074 CTGTCTTTGTAGATGGATTTTGG - Intergenic
1032863646 7:135904770-135904792 GTGTGTTTCTAGATGCATTTTGG + Intergenic
1034137440 7:148783787-148783809 CACTGTCTGTACATACATTTTGG - Exonic
1034248969 7:149672915-149672937 CTGTCTTTGTAGATGGATTTTGG - Intergenic
1034986926 7:155522072-155522094 CTGTGTGTGTGGATGCATGTGGG - Intronic
1036177956 8:6557099-6557121 GTGTGAATGAACATGAATTTGGG - Intronic
1036216226 8:6882202-6882224 GTGTGCATGTACGTGCATTTAGG + Intergenic
1036216232 8:6882346-6882368 GTGTGTGTGTACGTGCATTTAGG + Intergenic
1037731830 8:21532514-21532536 GTGTGCATGTGCATGCATGTAGG - Intergenic
1038120708 8:24611421-24611443 CTGTGGATATGCATGCCTTTAGG + Intergenic
1038276202 8:26122993-26123015 CTGTGTATGTAGATACATACAGG + Intergenic
1038911815 8:31973226-31973248 CTGTGGATATACAGGCTTTTGGG + Intronic
1039884844 8:41649008-41649030 CTGTGTGTGTACCTGCATTCAGG + Intronic
1041250458 8:55929419-55929441 CTGTGTGTGTACAGGCATAGTGG + Intronic
1042074613 8:64978221-64978243 CTGTGTGTGAAAATGCATTTTGG + Intergenic
1043216257 8:77592917-77592939 CTATTTATATACCTGCATTTAGG - Intergenic
1044793153 8:95868547-95868569 CTGTATAGTTACATGCATATTGG + Intergenic
1046241954 8:111508158-111508180 GTGTGTTTCTGCATGCATTTAGG - Intergenic
1046471016 8:114674189-114674211 CTGTTTATGTATTTGCACTTAGG + Intergenic
1046759263 8:118004303-118004325 TTGTGTATGCACGTGCATGTGGG + Intronic
1046884723 8:119353134-119353156 TTGTGTGTGTGCATGCATGTGGG + Intergenic
1049978358 9:881647-881669 CTGACTGTGTACATGTATTTAGG - Intronic
1050462038 9:5885280-5885302 CTGTGAATGTACAAACAGTTCGG - Intronic
1050764590 9:9116414-9116436 CTGAGTATGCACATGCATACAGG + Intronic
1051562324 9:18455765-18455787 ATGTGTATGTATGTACATTTTGG - Intergenic
1055699258 9:78924565-78924587 CTGTTTATATACATGCAATCTGG + Intergenic
1056024297 9:82476873-82476895 TTGTTTGTGTACATGTATTTGGG + Intergenic
1057526285 9:95805209-95805231 ATGTGTGTGTGCATGCATGTTGG + Intergenic
1058232064 9:102437957-102437979 ATGTAAATGTACATACATTTTGG - Intergenic
1058961517 9:109996769-109996791 CTGTGTGTGCACATGCACATGGG + Intronic
1059170642 9:112121420-112121442 ATGTGTATGTGCATACCTTTGGG + Intronic
1060436130 9:123594795-123594817 ATATATATGCACATGCATTTGGG - Intronic
1060575507 9:124688810-124688832 GTGTTTATGTACATGTATTTAGG + Intronic
1060759762 9:126237305-126237327 GTGTGCATGTGCATGCATTTGGG + Intergenic
1061835965 9:133330175-133330197 CTGTAGATGCACATACATTTAGG + Intergenic
1062190573 9:135245914-135245936 CTCTGGATATACATGAATTTGGG + Intergenic
1185843137 X:3411850-3411872 GTGTTTATGTACATGCCTGTGGG - Intergenic
1186061940 X:5718463-5718485 CTCTGTATGTTCCTGCATTTTGG - Intergenic
1186720933 X:12302981-12303003 CTGGCAATGAACATGCATTTTGG + Intronic
1187504223 X:19865767-19865789 CAGTGTGTGTACAGTCATTTGGG - Intronic
1188995183 X:36876075-36876097 CTGTGTCTGTAGATCCTTTTGGG - Intergenic
1189637108 X:43023094-43023116 CAGTGGAGGTACAGGCATTTGGG + Intergenic
1189905142 X:45751245-45751267 ATATATATGTACATGGATTTAGG - Intergenic
1190254942 X:48755275-48755297 CTGTGTGTGTACATGTGGTTGGG - Intergenic
1191167292 X:57404331-57404353 CTGTCTTTGTAGATGGATTTTGG + Intronic
1191965998 X:66758845-66758867 CTCTGTATTTAAATACATTTGGG - Intergenic
1192174308 X:68876243-68876265 CTGTGTGTGCACATGCTTGTAGG - Intergenic
1193172184 X:78349139-78349161 CTGTCTTTGTAGATGGATTTTGG + Intergenic
1193385208 X:80862202-80862224 CAGTCTATGTACATGTTTTTAGG + Intergenic
1194041048 X:88942397-88942419 CTGTCCATTTACATGCTTTTTGG + Intergenic
1194202009 X:90963777-90963799 CTGTTGATGTGCATGCGTTTAGG - Intergenic
1195514350 X:105755989-105756011 CTGTGTATGTGTATGCACTCTGG - Intronic
1195563671 X:106316190-106316212 GTGTGTGTGTGCATGCATTTAGG - Intergenic
1196123716 X:112077938-112077960 GTGTATTTGCACATGCATTTGGG + Intronic
1197111131 X:122776148-122776170 CTGTGTGGTTACATGCATGTTGG + Intergenic
1197171734 X:123442640-123442662 CTGTGTATATAAAATCATTTGGG + Intronic
1197852267 X:130875300-130875322 TTGTATTTGTACATGAATTTTGG - Intronic
1199682611 X:150237556-150237578 ATGTGTATGTACGTATATTTGGG - Intergenic
1200547846 Y:4539228-4539250 CTGTTGATGTGCATGCGTTTAGG - Intergenic
1200800937 Y:7386652-7386674 CTGTGTATGTATAACCATTGAGG - Intergenic