ID: 1154957757

View in Genome Browser
Species Human (GRCh38)
Location 18:21276065-21276087
Sequence AAACAGAATGAGAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1125
Summary {0: 1, 1: 2, 2: 8, 3: 88, 4: 1026}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154957757_1154957760 -3 Left 1154957757 18:21276065-21276087 CCTTCCTCATTCTCATTCTGTTT 0: 1
1: 2
2: 8
3: 88
4: 1026
Right 1154957760 18:21276085-21276107 TTTTATCTTGAACTTGTCTTGGG 0: 1
1: 0
2: 1
3: 36
4: 387
1154957757_1154957759 -4 Left 1154957757 18:21276065-21276087 CCTTCCTCATTCTCATTCTGTTT 0: 1
1: 2
2: 8
3: 88
4: 1026
Right 1154957759 18:21276084-21276106 GTTTTATCTTGAACTTGTCTTGG 0: 1
1: 0
2: 1
3: 18
4: 211
1154957757_1154957761 2 Left 1154957757 18:21276065-21276087 CCTTCCTCATTCTCATTCTGTTT 0: 1
1: 2
2: 8
3: 88
4: 1026
Right 1154957761 18:21276090-21276112 TCTTGAACTTGTCTTGGGTCAGG 0: 1
1: 0
2: 0
3: 14
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154957757 Original CRISPR AAACAGAATGAGAATGAGGA AGG (reversed) Intronic
901179551 1:7331845-7331867 AAGCAGAATAAGAAGGACGAGGG - Intronic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
901202929 1:7476794-7476816 TGACAGGATGAGGATGAGGATGG - Intronic
901366076 1:8749766-8749788 CAGCAGAATGAGAATCTGGAGGG + Intronic
901472685 1:9468522-9468544 AGACAGAATCAGAACGAAGATGG + Intergenic
901610725 1:10495880-10495902 AAAAAGAATGAAAATGGGGTGGG - Intronic
901851772 1:12020250-12020272 AAAAAGAAAGTGAAGGAGGAAGG + Intronic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
903332850 1:22605197-22605219 AAAAAGAAAGAGGAAGAGGAAGG + Intergenic
903377440 1:22875789-22875811 AAATAAAATGAGTATGAGAAGGG + Intronic
903500388 1:23797213-23797235 AAACAGAATAGGCATGAGGAGGG - Intronic
903575907 1:24339631-24339653 GACCAGAAGGAGAATCAGGAAGG - Intronic
903730829 1:25494116-25494138 TGACAGAATGAGCATGAAGAAGG + Intronic
903799458 1:25955710-25955732 AAAGAGAAAGAGAAAAAGGAAGG + Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904579740 1:31533566-31533588 AAACAGAAAGAAAAAGAGAAAGG - Intergenic
904797696 1:33069822-33069844 ATATAGAATGAGAGTGGGGAAGG - Intronic
904807737 1:33143572-33143594 AAGAGGAATGAGAACGAGGATGG - Intergenic
905121934 1:35688989-35689011 AAAGAGAAAGAGAAGGGGGATGG + Intergenic
905466393 1:38157112-38157134 AAATAGAATGGGAATGTGGTGGG - Intergenic
905479099 1:38248967-38248989 AAACAGAAACAAAATGGGGAGGG - Intergenic
905986060 1:42283553-42283575 AAAAAGAATAAGAATAATGAGGG + Intronic
906724128 1:48031215-48031237 AAGCAGAGTGATGATGAGGAGGG - Intergenic
907582999 1:55588768-55588790 TAACAGAAAGAGAATAAGCATGG + Intergenic
907952309 1:59195634-59195656 AAAAAGAAAGAGAAAAAGGAAGG - Intergenic
908295662 1:62710310-62710332 AAAAAGAATGAGAATTAGGGAGG - Intergenic
908481262 1:64541821-64541843 AAACAAAAACAGAATGAGGTGGG + Intronic
908696688 1:66850475-66850497 AAACAGGAAGAAAATGAGAAAGG + Intronic
908963797 1:69732770-69732792 AAATTAAATGTGAATGAGGATGG + Intronic
909092229 1:71240622-71240644 AAACAGAATAATAATGAGATTGG + Intergenic
909315479 1:74212373-74212395 AAACAGGATGAAAAGGATGAGGG - Intronic
909425558 1:75520558-75520580 AGAAAGAATGAGAAAGAGGAGGG + Intronic
909461857 1:75925787-75925809 AAATTGAAGGAGAATGAGAAGGG - Intronic
909665402 1:78126783-78126805 AAGCACAATGAGAAAGAGGGAGG + Intronic
910392930 1:86763000-86763022 AAACAGGAGGAGAAAGAGAAAGG - Intergenic
910474834 1:87595651-87595673 AAAAAGAAAGAGAAAGAGGAGGG - Intergenic
911014732 1:93320280-93320302 AAGCAGAATGAGCAAGAGGTGGG - Intergenic
912259143 1:108092051-108092073 AAAGAGGAGGAGAAGGAGGAAGG - Intergenic
912582950 1:110736569-110736591 GACAAGGATGAGAATGAGGAGGG - Intergenic
912595590 1:110872667-110872689 AGACAGAGGGAGTATGAGGAGGG + Intergenic
912602864 1:110955889-110955911 ATACACAATGAGAAGGAGGCAGG + Intronic
912851118 1:113125484-113125506 AAACAGAAATTGATTGAGGAAGG + Exonic
912945109 1:114078273-114078295 AAAGAGAAAGAGAAAGAGAAAGG + Intergenic
913252924 1:116927085-116927107 AAACAGAAGCAGAAAGAGCAAGG + Intronic
913267052 1:117055469-117055491 AAAAAGAATGAAACAGAGGAGGG + Intergenic
913653960 1:120943993-120944015 AAAGAGAAGGAGGAGGAGGAAGG - Intergenic
913691177 1:121281339-121281361 AAGAAGAAAGAGAATGAAGAAGG - Intronic
914146365 1:144998633-144998655 AAGAAGAAAGAGAATGAAGAAGG + Intronic
914644153 1:149638161-149638183 AAAGAGAAGGAGGAGGAGGAAGG - Intergenic
915755413 1:158255031-158255053 AAAGACATTGAGAAAGAGGATGG - Intronic
915802275 1:158807108-158807130 AGAGAGAATGAGGCTGAGGAGGG + Intergenic
915911416 1:159917953-159917975 AAAGCAAGTGAGAATGAGGATGG + Intergenic
915917830 1:159951690-159951712 AAACAGAATGAAATTGAGGAAGG - Exonic
916627696 1:166576395-166576417 AAAGACAATGAAAATGATGAAGG + Intergenic
916739998 1:167639466-167639488 AAAAACAATGAGAATGAAAATGG - Intronic
917138049 1:171806709-171806731 AAAGAAAAAGAGAAAGAGGAAGG - Intronic
917198170 1:172488327-172488349 AACTAGAATAAGAATTAGGAGGG + Intergenic
917695603 1:177520088-177520110 AAGCAGAATGAGCCTGGGGAAGG + Intergenic
917710855 1:177682682-177682704 AAGCAAAATGAGAATGAGAAAGG - Intergenic
917890129 1:179428618-179428640 TAAAAGAATGAGAATGAAAAAGG - Intronic
918069512 1:181124595-181124617 AAGCAGAAGGAGGAGGAGGAGGG - Intergenic
918736410 1:188069672-188069694 ACACACAATGAGAAAGAGAATGG - Intergenic
918970536 1:191410637-191410659 GAACAGAAAAATAATGAGGAAGG + Intergenic
918974518 1:191464810-191464832 ATACATGATGAGAATGAGGTTGG + Intergenic
919003043 1:191859620-191859642 AAACAGAAGGAGAGAGAGGAAGG - Intergenic
919016764 1:192048504-192048526 AAAAAGAAGGAGAAGGAGAAGGG + Intergenic
919259126 1:195167121-195167143 AAAAAGAGTGAGAAAAAGGAAGG + Intergenic
919548448 1:198953234-198953256 TTAAAGAAGGAGAATGAGGAAGG - Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919665211 1:200284963-200284985 AGAAAGAAAGAGAAAGAGGAAGG + Intergenic
919716020 1:200777386-200777408 AAACACAATGAGAAGAAGCATGG + Intronic
919877216 1:201878403-201878425 ACACAGACTGAGAATGATGGGGG + Exonic
919980645 1:202641071-202641093 AAACAGAATGAGAATAGTGGTGG - Intronic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
920478501 1:206299815-206299837 AAGAAGAAAGAGAATGAAGAAGG - Intronic
921236350 1:213135719-213135741 AAACAGAATGCTGATGAGGAGGG - Intronic
921243470 1:213211363-213211385 AATCAAAATGAGAATGACAAAGG + Intronic
921511659 1:216038493-216038515 AAATAGAATAAGAAAGTGGAGGG - Intronic
921543100 1:216442693-216442715 AAAAAGAAGGAGGAGGAGGAGGG + Intergenic
921795415 1:219338067-219338089 ACGTAAAATGAGAATGAGGAAGG - Intergenic
922040190 1:221888847-221888869 GAACAGTGTGAGAAGGAGGATGG + Intergenic
922040197 1:221888892-221888914 GAACAGTGTGAGAAGGAGGATGG + Intergenic
922330879 1:224574578-224574600 TACCAGAATGAGAATGACGTGGG + Intronic
922661906 1:227437518-227437540 AGAAAGAAAGAGAAAGAGGAGGG + Intergenic
923069433 1:230549263-230549285 CCACAGAATGAGGGTGAGGAGGG + Intergenic
923304358 1:232674505-232674527 AAACAGAAAGGGAAAAAGGAAGG + Intergenic
923330910 1:232923834-232923856 AAGCAGAGTGAGAATGAGTCAGG - Intergenic
923455711 1:234163386-234163408 ACACAGAATGGGACAGAGGAAGG + Intronic
924263590 1:242256884-242256906 AAAAAGAAAGAGAAAGAAGAGGG - Intronic
924543392 1:245002450-245002472 AAACAGAATGAGAGTACGCAAGG - Intronic
924680363 1:246224879-246224901 AAACAGAAGCAGAAAAAGGAAGG + Intronic
1062844465 10:693145-693167 GAGCAGAATGAGACCGAGGAAGG - Intergenic
1063090707 10:2863950-2863972 TCACAAATTGAGAATGAGGAGGG + Intergenic
1063181164 10:3601696-3601718 ACACAGAAATAGAATGAGGAAGG + Intergenic
1063534224 10:6867065-6867087 AAAGAGAAAGAGAAGGAGGGAGG - Intergenic
1063656368 10:7994095-7994117 AAAGAGAAAGAGAAAGAAGAAGG - Intronic
1063717739 10:8545289-8545311 AAAAAGAATAAGAAGAAGGAAGG - Intergenic
1064096731 10:12429325-12429347 AAAGAGAGAGAGAATGGGGAAGG - Intronic
1064769035 10:18704835-18704857 AGAAAGAAAGAGAAAGAGGAAGG - Intergenic
1065130065 10:22611805-22611827 AAACACAATGCGAATGAAGCTGG + Intronic
1065293951 10:24257436-24257458 AAAGAAAATGAGAAAGGGGAAGG - Intronic
1065416890 10:25498044-25498066 GAGCAGAAAGAGAAAGAGGAAGG + Intronic
1065461516 10:25971041-25971063 ATACAGAATGAAAATGAAAAGGG - Intronic
1065502693 10:26397786-26397808 AATCAGAATCTGAATGAGGGTGG - Intergenic
1065569515 10:27056040-27056062 AATCACAAAGAGAATTAGGAGGG - Intronic
1065752442 10:28899457-28899479 GAACACAAAGAGAAAGAGGAGGG - Intergenic
1065775670 10:29117418-29117440 ATAAAAAATGAAAATGAGGAGGG + Intergenic
1065988515 10:30982082-30982104 AAAAAGAAAGAGAAAAAGGATGG - Intronic
1066721205 10:38341614-38341636 AAAAAGAAAGAGAAAGAAGAGGG + Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067241023 10:44493694-44493716 AAAAAGAAAGAGAAGGATGAAGG - Intergenic
1067826874 10:49581531-49581553 AAACAGATTAAGAGTCAGGATGG + Intergenic
1068051593 10:51956965-51956987 AAAGAGAGAGAGAAAGAGGAAGG - Intronic
1068318448 10:55378808-55378830 AAAGAGAGTGAGAAAAAGGAGGG - Intronic
1068638120 10:59370074-59370096 AAAGAGTATGATAAAGAGGATGG - Intergenic
1068691656 10:59922040-59922062 ACAAAGAATGAAAATGAGGGGGG - Intergenic
1068803751 10:61171660-61171682 AAACTGAAGAAAAATGAGGAGGG + Intergenic
1068803862 10:61172721-61172743 AAAGAGAAAGAGAAAGAGGAAGG + Intergenic
1069689148 10:70338194-70338216 AAACAGAAGGACAAGGAGGAGGG - Intronic
1069729442 10:70601350-70601372 AAACAGAGTGAGAGTCAGGGTGG - Intronic
1070179036 10:73997512-73997534 AAACAGAATGTCTTTGAGGAGGG + Intergenic
1070379567 10:75868581-75868603 AAACAGAATCAGAATTTGAATGG + Intronic
1070515949 10:77206597-77206619 AAACAGAAAGAAGATGAGTATGG - Intronic
1070531492 10:77341466-77341488 AACCTGAATGGGAATGAGGGAGG - Intronic
1070729338 10:78814480-78814502 AAAAAAAATGAGAGTGTGGAGGG - Intergenic
1070983495 10:80668581-80668603 ATACAGGATGAGCATGTGGATGG + Intergenic
1071230399 10:83579557-83579579 AAAAAGAACAAGAATGAAGAGGG + Intergenic
1071812927 10:89203257-89203279 GAACAGCTGGAGAATGAGGATGG + Intergenic
1071944801 10:90632357-90632379 AAAGAGAGTGAGAGTGAGAAAGG + Intergenic
1072054962 10:91745729-91745751 AAAGAGAAGGAGAAGGAAGAAGG + Intergenic
1072214376 10:93275771-93275793 AAAGAGAATGAAAATAAGTAGGG + Intergenic
1072576268 10:96703337-96703359 AAACACAATGGGAATGGAGAGGG + Intronic
1072580638 10:96736912-96736934 AAAAAGAATGGGGATGGGGAGGG - Intergenic
1072822245 10:98569543-98569565 AATGAGAATGAGAATGAATATGG - Intronic
1073473288 10:103737061-103737083 AAACGGAATGAGAGAAAGGAAGG + Intronic
1073803306 10:107067754-107067776 AAACTGAATGAGAATCAGAGAGG - Intronic
1073849215 10:107595015-107595037 ATACTGAATGAGATTGTGGAAGG + Intergenic
1074042353 10:109803495-109803517 AAACACAATTAGAATGACAAAGG + Intergenic
1074146222 10:110719851-110719873 AAACAGAATAAGACAGAGGTGGG - Intronic
1074222613 10:111453239-111453261 ATACACAATGAGGATGATGATGG + Intergenic
1074561901 10:114542608-114542630 AAAAAGAAAGAGAAAGAAGAAGG + Intronic
1074804371 10:117033321-117033343 AAACAAAATCAGAATGAAAAAGG + Intronic
1074831467 10:117252601-117252623 AAGAAGAAAGAGAATGAGGGAGG + Intronic
1074939916 10:118224626-118224648 AAACAGAAAGAAAATGATAAAGG + Intergenic
1075352964 10:121742489-121742511 AAACAGGATGAAAAACAGGAGGG - Exonic
1076150314 10:128157058-128157080 AAACAGGCTGAGCATGGGGAGGG - Intergenic
1076239053 10:128888783-128888805 AAGAAGGATGAGAATGAGGCAGG + Intergenic
1076492192 10:130869443-130869465 AAACAGAAACAGAATGAAGTAGG - Intergenic
1076816514 10:132917713-132917735 AAACAAAATGAATATGAGGGAGG - Intronic
1077515587 11:3000145-3000167 AAACAGCATGCGCATGCGGAGGG + Intergenic
1077576004 11:3383894-3383916 AAAAAAAAAGAAAATGAGGAGGG + Intergenic
1077856276 11:6129337-6129359 AAAGAGAATGAGGATAAGGTGGG - Intergenic
1077871176 11:6262748-6262770 AAATAGCATGAGATTGAGGAAGG + Intronic
1077872582 11:6274638-6274660 AAACATAATGATAATGATAATGG + Intergenic
1078357948 11:10646881-10646903 TAGCTGAAGGAGAATGAGGAAGG - Intronic
1078357958 11:10646951-10646973 TGACTGAAGGAGAATGAGGAAGG + Intronic
1078423745 11:11233042-11233064 AAATAGAGGGAGACTGAGGATGG + Intergenic
1078441176 11:11369772-11369794 CAACACAATGAGAAAAAGGAAGG - Intronic
1079192479 11:18291749-18291771 AAACAGCATGTGAATGTGTAAGG - Exonic
1079271288 11:18988310-18988332 AAAAAGAAGGGTAATGAGGATGG + Intergenic
1079311974 11:19374905-19374927 TAAAAGACTGAGAATCAGGAAGG - Intronic
1079607036 11:22382840-22382862 AAACCAAATGTAAATGAGGAAGG - Intergenic
1079633361 11:22705904-22705926 AAGCAGAATGGGAATAAGCAAGG + Intronic
1079819115 11:25102762-25102784 AAACAGATTGATAATGATGTGGG - Intergenic
1080217772 11:29865254-29865276 AGATAGAATGAGAAGAAGGAAGG - Intergenic
1080659836 11:34286703-34286725 AAACAGCATGAAAATGGTGATGG - Intronic
1080992741 11:37559220-37559242 AAAAAAAATGAGAATGAAAATGG + Intergenic
1081557345 11:44177458-44177480 AAACAGAAGTAAAATGAGGAGGG - Intronic
1081897311 11:46597650-46597672 AAAAAAAAAGAGGATGAGGATGG + Intergenic
1082796523 11:57381796-57381818 AAAAAAGATGAGAAAGAGGAAGG - Intergenic
1083067469 11:59939707-59939729 GAAGAGAAAGAGAAAGAGGAAGG - Intergenic
1083082031 11:60104026-60104048 AAACAGAAGTAGACTGTGGATGG - Intergenic
1083450492 11:62741312-62741334 AAACAAAAAAAAAATGAGGAAGG + Intergenic
1083522102 11:63323719-63323741 AAACACAATAAAAATGATGAAGG + Intronic
1083690094 11:64402530-64402552 AAATAAAATGAGGAAGAGGAGGG - Intergenic
1085993058 11:81874916-81874938 AAAGAGAAAGAGAAAGAGAATGG + Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086164425 11:83761158-83761180 AAGCAGAATGACAGTGAGAATGG + Intronic
1086166335 11:83783222-83783244 ACACTGAATAAGATTGAGGATGG + Intronic
1086221640 11:84452250-84452272 AAACAGAATGAGGAGGAAAATGG + Intronic
1087067831 11:94044125-94044147 AAATAGACCGAGAATGGGGAAGG + Intronic
1087307073 11:96500597-96500619 CAGCTGAATGAGAAGGAGGAGGG - Intronic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087736925 11:101844670-101844692 AAAGAGAGAGAGAAAGAGGAAGG + Intronic
1087748716 11:101980998-101981020 AAACAGAATGGTAATAAAGAAGG + Intronic
1087749991 11:101996742-101996764 AAACAGATTCAGGATGAAGAGGG + Intronic
1087813034 11:102629179-102629201 AAAAAGAAAGAGAAAAAGGAAGG + Intergenic
1088030783 11:105246929-105246951 AAACAGATGGGGATTGAGGAAGG + Intergenic
1088031904 11:105261845-105261867 AAACAGAATGAAACTGAACAGGG + Intergenic
1088072064 11:105799331-105799353 AAAAAGAAAGAAACTGAGGATGG + Intronic
1088381277 11:109195117-109195139 AAAGAGAGAGAGAAAGAGGAAGG - Intergenic
1088738344 11:112746842-112746864 AAACAGAAAGACAGAGAGGAAGG + Intergenic
1089529715 11:119119341-119119363 AATCTGAATTAAAATGAGGATGG + Intergenic
1089646633 11:119884687-119884709 AAGCAGAATGAAAGTGAGGGCGG - Intergenic
1089778424 11:120855929-120855951 AAAGAGGAAGAGAAAGAGGAAGG + Intronic
1089891325 11:121884259-121884281 GGACAGAATGAGAAGGAGGGAGG + Intergenic
1089933598 11:122340130-122340152 AAAGAGAAGGAGGAGGAGGATGG + Intergenic
1089991699 11:122867475-122867497 GAAGAGTATGAAAATGAGGAAGG - Exonic
1090284082 11:125483998-125484020 AATGTGAAAGAGAATGAGGATGG - Intronic
1090301247 11:125641697-125641719 AAAGAGAATGAGAAAAATGAAGG - Intronic
1090864650 11:130688602-130688624 AAACAGAAAAAGAAAGAGAAAGG + Intronic
1090968924 11:131622973-131622995 AAAGAGAAAGAGGAAGAGGAAGG + Intronic
1091794020 12:3287119-3287141 GAACAAAATCAGGATGAGGATGG + Intergenic
1091852559 12:3712088-3712110 AGACAGGATGAGAATAGGGAAGG - Intronic
1092053911 12:5493256-5493278 CAACAGAATGAGAGCGTGGATGG + Intronic
1092532203 12:9353920-9353942 ACTCAGAAAGAGAAGGAGGAAGG - Intergenic
1092560408 12:9607239-9607261 AAAGAAAAAGAGAAGGAGGAAGG - Intronic
1092708501 12:11309341-11309363 AAACAGATTGAGAATGAATTGGG + Intronic
1093304821 12:17502411-17502433 AAACAGGATGAAAAAGAGAAAGG + Intergenic
1093306377 12:17526000-17526022 ATACACAATGAGATTGAGAAAGG - Intergenic
1094066901 12:26371006-26371028 AAACAGAATGAAATTGAAGATGG - Intronic
1094324897 12:29226948-29226970 AAACACAATGAGAAGGAAGAAGG + Intronic
1094709210 12:32944200-32944222 AAATAGAATGAAAATGAGTGAGG - Intergenic
1094774493 12:33708601-33708623 AAATAGAATGAAGATGAGGGAGG + Intergenic
1095823663 12:46508638-46508660 ATAAAGAATGAGGAAGAGGATGG + Intergenic
1095843560 12:46721235-46721257 AAAGAGAAGGAGAATAAAGATGG - Intergenic
1095900769 12:47325724-47325746 AAAGAGAATGAGAATGAGATAGG + Intergenic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096462532 12:51829866-51829888 AAAGAGAATGGGAAGGAGGAAGG + Intergenic
1096667818 12:53178493-53178515 AAACAGAATGAAAATAGGGCCGG + Intronic
1096729982 12:53601660-53601682 AAATAGAATCAGAAGGGGGAAGG - Intronic
1097755647 12:63404155-63404177 AAACAAAAAGACAATTAGGAGGG - Intergenic
1097964110 12:65560802-65560824 AAACAGAAAGAGAAGGAGTGAGG - Intergenic
1098082137 12:66798626-66798648 AAACAGTATTAGAGTTAGGAGGG - Intronic
1098170890 12:67746076-67746098 AAACAGGAGGAGTGTGAGGAAGG - Intergenic
1098225705 12:68320610-68320632 AAACAGAAGGATAATTTGGATGG - Intronic
1098361226 12:69656188-69656210 TGACAGAATGAGAATGAAAAAGG + Intronic
1098558205 12:71842852-71842874 AAAGAAAAAGAAAATGAGGAGGG + Intronic
1098589920 12:72198960-72198982 AAACAGAGAGAGAATGAGGCAGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098854412 12:75636210-75636232 ATACAGGATGAGAAGGAGGTAGG - Intergenic
1098958948 12:76718372-76718394 AAAGAGGATGAGGATGAGGCAGG + Intergenic
1099081066 12:78181843-78181865 ATACAGAAGGAGAAGGAGAAGGG + Intronic
1099109220 12:78536295-78536317 AAGCAGAATGAGAACCAGCAGGG + Intergenic
1099621158 12:85004424-85004446 ATAGAGCATGAGAATGAGCAGGG - Intergenic
1100723600 12:97385367-97385389 ACACAGACTGAGAATAAGGGAGG + Intergenic
1101221825 12:102649615-102649637 AAGAAATATGAGAATGAGGATGG + Intergenic
1101305484 12:103523834-103523856 AAACAGATTCAGAATGTGTAGGG + Intergenic
1101711974 12:107275968-107275990 AGACAGAATCAGAATTAGGCTGG + Intergenic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102398456 12:112608096-112608118 AAAAAGAAAGAGGAGGAGGAGGG - Intronic
1102484173 12:113244965-113244987 TAAGAAAATGAGAATGAGGCTGG + Intronic
1102705712 12:114878489-114878511 AAACAGAAAGGAAATAAGGAAGG - Intergenic
1102899320 12:116624090-116624112 AAGGAGAAAGAGAATGAAGAAGG + Intergenic
1104192703 12:126498643-126498665 ACATAGACTGAGAGTGAGGAAGG - Intergenic
1104277854 12:127346449-127346471 AAACAGATGAAGAAGGAGGAAGG + Intergenic
1104369753 12:128213509-128213531 AAACAAAATAAAATTGAGGAGGG + Intergenic
1104550045 12:129748347-129748369 ACGGAGAATGAGACTGAGGAGGG + Intronic
1104613339 12:130248108-130248130 AAAAAGAAGGAGGAGGAGGAGGG + Intergenic
1104701409 12:130907290-130907312 AGACAGAATGAGGATGTGGCTGG - Intergenic
1104850165 12:131868876-131868898 AAACAGAAGGATTTTGAGGAGGG - Intergenic
1105444852 13:20444546-20444568 AAACATCATTGGAATGAGGATGG - Intronic
1105664470 13:22537197-22537219 AAAGAAAATGGGAGTGAGGAAGG + Intergenic
1106010743 13:25819521-25819543 AAACAGCATGAGATTGACAAAGG - Intronic
1106654921 13:31732932-31732954 GAACAGAAAGAGAACGAGGGAGG - Intergenic
1106663614 13:31828084-31828106 GAACAAAAAGAGAAGGAGGAAGG - Intergenic
1106812005 13:33368030-33368052 AATAAGAAAGAGAAAGAGGAAGG - Intergenic
1106899248 13:34337646-34337668 AAAGAGCAGGAGAAAGAGGAGGG + Intergenic
1107201109 13:37718824-37718846 TAACAGAAAGAGAATGAGTCAGG + Intronic
1107216847 13:37931669-37931691 AAAGAGAAAGAGAATGAAGAGGG - Intergenic
1107669630 13:42731500-42731522 GCACAGAGTGTGAATGAGGAAGG + Intergenic
1107742120 13:43461724-43461746 AAGCAGTTTGAGAATGAGTAGGG + Intronic
1107993307 13:45837432-45837454 AAAAAGAATGAAAAAAAGGAAGG + Intronic
1108078850 13:46711449-46711471 AATCATAATTAAAATGAGGATGG + Intronic
1109473053 13:62835979-62836001 AAAAAGAAAGAGAGGGAGGAAGG - Intergenic
1109609872 13:64750736-64750758 AAACAGTATGAGCGTGAGTAGGG - Intergenic
1109790094 13:67235231-67235253 AAACATTATAAGAATGAAGAAGG - Intergenic
1109941056 13:69365974-69365996 AAACAGAGTGAGAGGGAGAAAGG + Intergenic
1110150318 13:72244200-72244222 ATACAGAGAGAGAATGAGAAAGG + Intergenic
1110868875 13:80427148-80427170 AAACTGAATAAGAGTGATGAGGG + Intergenic
1111027146 13:82542866-82542888 AAAGAGAAAGAGAGAGAGGAGGG + Intergenic
1111873065 13:93858688-93858710 AAAGAGTATGAGAATGAGAATGG + Intronic
1111956121 13:94760478-94760500 AAAGAGGAAGAGAAGGAGGAAGG - Intergenic
1112097951 13:96156005-96156027 AAAGAGAATGACAATCATGAGGG - Intronic
1112185224 13:97121648-97121670 AAAGAGAATAAGAATGTGGAAGG - Intergenic
1112416231 13:99205609-99205631 AAACAGATTGAGATGGAGGCAGG + Intronic
1112810846 13:103216842-103216864 AAATAGGAGGAGAATGATGAAGG - Intergenic
1113088754 13:106595531-106595553 AAACACAAAGAATATGAGGAAGG + Intergenic
1113245138 13:108386798-108386820 AGAGAGAATCAGAATAAGGATGG - Intergenic
1113363349 13:109652305-109652327 AAACAGACTGAGAAGGGAGAGGG - Intergenic
1113799624 13:113079694-113079716 AAACAGGATGGGAAGGAAGAGGG + Intronic
1114042542 14:18692373-18692395 AACCAGGACGAGAAAGAGGAGGG + Intergenic
1114134329 14:19829883-19829905 AAACAGAGTGAGAATAGAGAAGG - Intergenic
1114257296 14:21014297-21014319 AAAGAGAAGGAAAAAGAGGAAGG + Intergenic
1114346441 14:21800299-21800321 AAAGAGAAAGAGGAGGAGGAGGG + Intergenic
1114356425 14:21914421-21914443 GAACAGAAAGAGAATAGGGAGGG + Intergenic
1114530076 14:23389953-23389975 GAAGAGAATGAGAATGACAAGGG + Intronic
1115114590 14:29864745-29864767 CAAGAGCATGAGATTGAGGAGGG + Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115888039 14:37995350-37995372 AGACAGAATGAGAAAAAGCATGG - Intronic
1116162052 14:41280457-41280479 AGACAGAAAGAGAAGAAGGAAGG + Intergenic
1116427342 14:44807100-44807122 AGAAAGAAAGAGAAAGAGGAAGG + Intergenic
1116558164 14:46339896-46339918 AAACATAGTGACAATGAGGTGGG + Intergenic
1116944664 14:50825277-50825299 GAACAGACTGAGAATGGGCAGGG + Intronic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117899043 14:60514762-60514784 AAAGAGAATGTGAATGGGGCGGG + Intronic
1117946846 14:61035973-61035995 ATACAGAATGAGAAAAAGGTAGG - Intronic
1118085509 14:62411284-62411306 ACACAGAATGTGAGTGAGGGAGG - Intergenic
1118433178 14:65742879-65742901 CAACAGATTCAGAATGAGAATGG + Exonic
1118556195 14:67025437-67025459 AAACAGAAAGAGAACAAGGAAGG - Intronic
1118559045 14:67057686-67057708 AACAAGAAAGAGAAAGAGGAAGG - Intronic
1118586500 14:67358726-67358748 AAACAGGATGAGGAGGAGAAAGG + Intronic
1119359112 14:74033016-74033038 AGAAAGAAGGAGGATGAGGAAGG - Intronic
1119663306 14:76466292-76466314 AAACACAAGGAGAATGTGGCTGG - Intronic
1120220419 14:81725802-81725824 AAATGGATTGAGAATGAGCATGG - Intergenic
1120340171 14:83209178-83209200 GAAAAGAATAACAATGAGGAGGG + Intergenic
1120542617 14:85769014-85769036 AAACAGAATGAAAGTGCAGAGGG - Intergenic
1120655856 14:87189132-87189154 AAGCAGAAGGAGAATTTGGATGG - Intergenic
1120668029 14:87330335-87330357 AATGAGAATAATAATGAGGATGG - Intergenic
1120673988 14:87397482-87397504 CCACAGAATTAGAAGGAGGAAGG - Intergenic
1121111602 14:91316788-91316810 CCACAGAATGAGAAAGATGAGGG - Intronic
1121142248 14:91553936-91553958 AAAGAGACTGAGAAAGAAGATGG - Intergenic
1121550097 14:94792834-94792856 AGAGAGAAAGAGAAAGAGGAAGG + Intergenic
1122017803 14:98811039-98811061 TAACACAATAAGAAAGAGGATGG - Intergenic
1122546517 14:102525748-102525770 AAAGAGAAAGAGAAAAAGGAGGG - Intergenic
1124399186 15:29333584-29333606 AAATGGAATGCAAATGAGGAAGG - Intronic
1124620290 15:31270166-31270188 AAAGAGAAAGAGAGTGAGCAGGG + Intergenic
1124622708 15:31284877-31284899 ACACAGCATAAGAATGAAGATGG + Intergenic
1124882856 15:33658465-33658487 AAACAGAATGACAAAGATGAAGG - Intronic
1124916509 15:33980027-33980049 AAAAAGAATGAGAATAACAAGGG + Intronic
1125255476 15:37758399-37758421 AGAAAGAAAGAGAAAGAGGAAGG + Intergenic
1125480633 15:40077275-40077297 AAAAAGAAAGAGAAAGAGGGAGG + Intergenic
1125896466 15:43306980-43307002 AGAATGAATGAGAATGAGGCTGG - Intergenic
1126097632 15:45100639-45100661 AAATGGAATGAGACTCAGGATGG + Intronic
1126442735 15:48709007-48709029 AAACAGACCGATAATGAGTAGGG - Intergenic
1126532486 15:49726250-49726272 AAAAAGAATGAAAAAGAGCAAGG + Intergenic
1126759406 15:51955606-51955628 AGAAAGAATGAGAATGAAGCTGG + Intronic
1127075740 15:55323833-55323855 AAAAAGAAAGAGGAAGAGGAGGG + Intronic
1127765731 15:62184203-62184225 AAAGAGAAAGAAAATAAGGAAGG + Intergenic
1128095609 15:64952253-64952275 AAAAAGAAGGAGAAGGAAGAAGG - Intronic
1128109225 15:65066186-65066208 AAAGAGAAAGAGAAAAAGGAAGG + Intronic
1128393913 15:67203844-67203866 AAAAAGAAAGAGAACGAAGATGG + Intronic
1128467308 15:67923675-67923697 ACACAGACTGAGAATGGGGAAGG - Intergenic
1128656197 15:69463701-69463723 AAAGAGAAAGAGGAGGAGGAGGG - Intergenic
1128674592 15:69599409-69599431 ACACTGAAGGAGAGTGAGGAAGG + Intergenic
1128687722 15:69699247-69699269 AAATAGTATGAGAATGTGGTTGG - Intergenic
1129008949 15:72397218-72397240 AAAAAGAATGAGAAATCGGATGG + Intergenic
1129354414 15:74980001-74980023 AAAGAGAGAGAGAATGAGGAGGG - Intronic
1129880974 15:79005813-79005835 AAAGAGAAAGGAAATGAGGAGGG - Intronic
1130127399 15:81105252-81105274 AGAAAGAAAGAGAAAGAGGAAGG - Intronic
1130205315 15:81870071-81870093 AAAGAGATAGAGAATGGGGAGGG - Intergenic
1130404620 15:83587178-83587200 AAACAGAATGAGGCAGGGGAAGG - Intronic
1130719153 15:86369852-86369874 AAACAGAATTACAAGGAGGTAGG + Intronic
1131724956 15:95211602-95211624 AGATTGAATGAGGATGAGGAGGG - Intergenic
1131898894 15:97066160-97066182 AAATAGGAGGAGAATGAAGAGGG - Intergenic
1131901131 15:97088768-97088790 AAAAGGAAGGAGAAGGAGGAGGG - Intergenic
1132923168 16:2410797-2410819 CAGCAGACTGGGAATGAGGAAGG - Intergenic
1133064386 16:3195730-3195752 AAACAGAAAAAGAAAGAGGGTGG - Intergenic
1133597978 16:7311275-7311297 AAACAGAATCAAAATTAGGAAGG + Intronic
1133735370 16:8610994-8611016 CCACAGAATCAGACTGAGGATGG + Intergenic
1133887359 16:9843000-9843022 AAACAGAAAGAGAAAAAGGGGGG + Intronic
1134115081 16:11542016-11542038 AGAAAGAAAGAGAATGAGAAAGG - Intergenic
1134331497 16:13255259-13255281 AGACAGAAAGAGAATGAGAGAGG - Intergenic
1134751411 16:16628261-16628283 AAAAAGAAAGAGAAAGAGGAAGG - Intergenic
1134822556 16:17258414-17258436 AACCAGGAAGAAAATGAGGAAGG + Intronic
1135126148 16:19810813-19810835 AAAAAGAAAGAAAATGGGGATGG + Intronic
1135667397 16:24347361-24347383 AAAGAGAAAGAGAAAGAGAAGGG + Intronic
1136027123 16:27475683-27475705 AAAGAACATGAGAGTGAGGAAGG - Intronic
1136577904 16:31135174-31135196 AGAAAGAAAGAGAAAGAGGAGGG + Intronic
1137652986 16:50136295-50136317 AAACTGAATGGGAATGTGGTGGG + Intergenic
1137914234 16:52411399-52411421 AAATAGATTTAGAATGAGGAAGG - Intergenic
1138264621 16:55651671-55651693 AGACAGAATGAAAAGGAAGAAGG + Intergenic
1139309850 16:66019148-66019170 AAACATAAAGAGAGTGAGCAAGG + Intergenic
1139478644 16:67216045-67216067 AAAGAGCAGGAGAAGGAGGAAGG - Intronic
1139625509 16:68185472-68185494 AACCTGAATGAGAAAGAAGAGGG + Intronic
1140153146 16:72392903-72392925 AAAGAGAATGAGAAAAAGGATGG + Intergenic
1140459452 16:75127400-75127422 AAAAAGCATGAGCATGAAGAGGG + Intergenic
1140506998 16:75479751-75479773 AACCAGAAAGAGGAGGAGGAAGG + Exonic
1140761598 16:78113825-78113847 AAATAGAATGAGGATGAGGATGG + Intronic
1140942756 16:79737187-79737209 AAGCTGAATTAGAATGAGGGAGG - Intergenic
1141007183 16:80363331-80363353 GGACAGAAAGAGGATGAGGAAGG + Intergenic
1141113718 16:81290952-81290974 AAAGAGAAAGAGACAGAGGAAGG - Exonic
1141302691 16:82832446-82832468 AAGGAGGATGAGAAGGAGGAAGG - Intronic
1141307054 16:82874783-82874805 AAACAGAATGAGAGTAAGTGGGG + Intronic
1141544148 16:84752465-84752487 TAAAAGAATAAAAATGAGGAAGG - Intronic
1141907754 16:87038712-87038734 AAAGAGAAAGAGAAAGAGAAAGG + Intergenic
1142917754 17:3155917-3155939 CCACAGAATGAGAAAAAGGAAGG + Intergenic
1142933521 17:3308619-3308641 AAGCAGATTGAGATTGAAGAAGG + Intergenic
1143113851 17:4569736-4569758 AAACAGACTGAGAAGGTGCAAGG - Intergenic
1143336070 17:6172450-6172472 AAAAAGAATGAGAATGAGATAGG - Intergenic
1143399253 17:6631566-6631588 AGACAGCAAGAGAAGGAGGAAGG + Intronic
1143655454 17:8291107-8291129 AAAAACAGTGAGAAGGAGGAAGG + Intronic
1143764062 17:9126179-9126201 AAACCAAATGATAATGAGGTAGG - Intronic
1143951289 17:10634657-10634679 AAACAGAATGGGAATGGGCTGGG - Intronic
1144326833 17:14190541-14190563 CAACAGAATGAGAATTTTGATGG - Intronic
1144417964 17:15069613-15069635 AAACTAAATGAGAATGACTATGG + Intergenic
1144594485 17:16556636-16556658 GAAGAAAATGAGAATGTGGATGG + Intronic
1144610110 17:16703942-16703964 AAACAGAATGAGAGTGAAAATGG + Intronic
1144840338 17:18182243-18182265 AAAAAGAACGAGGAGGAGGAGGG + Intergenic
1144902635 17:18611477-18611499 AAACAGAATGAGAGTGAAAATGG - Intergenic
1144928428 17:18834503-18834525 AAACAGAATGAGAGTGAAAATGG + Intergenic
1144964782 17:19070124-19070146 AAATAGAAGGAAAAGGAGGAGGG - Intergenic
1144983185 17:19182054-19182076 AAATAGAAGGAAAAGGAGGAGGG + Intergenic
1144985040 17:19196185-19196207 AAATAGAAGGAAAAGGAGGAGGG - Intergenic
1146179306 17:30687102-30687124 AAAAAGACTGTGAAGGAGGAAGG - Intergenic
1146381821 17:32335897-32335919 ATTCAGAATGTGAATGGGGAAGG + Intronic
1146709511 17:35028754-35028776 AAAAAGAATGAGAACCAGCAAGG + Intronic
1146936369 17:36814869-36814891 AGAGAGAATGAGAAAGAGGAAGG - Intergenic
1147511898 17:41076990-41077012 AGAAAGAAAGAGAAAGAGGAAGG + Intergenic
1147846941 17:43411121-43411143 AAACAGAAAGAGAAAGAAGGTGG - Intergenic
1148015968 17:44522947-44522969 AAAAAAAAAGAGAATGAGGATGG - Intergenic
1148458677 17:47825030-47825052 AAAAAGAATCAGGATGAGGTTGG + Intronic
1148467576 17:47874075-47874097 AAAAAGAAGAAGAAGGAGGAGGG - Intergenic
1148481685 17:47963740-47963762 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1148571176 17:48670534-48670556 AAACAGAGAGAGAAAGAAGAAGG - Intergenic
1148669875 17:49402551-49402573 AAACAGCAGGAAAAGGAGGAAGG + Intronic
1148672665 17:49422693-49422715 TACCTGAATGAGAATGAGAAAGG - Intronic
1148807081 17:50269357-50269379 AAGCAGAAAGAGTAAGAGGAGGG + Intergenic
1149114175 17:53071794-53071816 AAAGAAAAAGAGAAAGAGGAGGG + Intergenic
1149351767 17:55796044-55796066 AAACAGAAAGTGAATGAGGATGG + Intronic
1149368698 17:55971166-55971188 AATGAGAATGAGAATGAGAATGG + Intergenic
1149864936 17:60146151-60146173 AAACAGAATGAGAAAAGGCATGG - Intergenic
1149969514 17:61202479-61202501 AAAAAAAAAGAAAATGAGGAGGG - Intronic
1150037694 17:61821476-61821498 AAAGAGAATGAAATTGAGGCAGG - Intronic
1150465198 17:65386688-65386710 GAAAAGAAAGAGAAAGAGGAAGG - Intergenic
1150973363 17:70056100-70056122 AAACAGAATCAGACTGAGGAAGG + Intronic
1151988157 17:77557223-77557245 AAAGAGAAAGAGAAAGAGAAGGG - Intergenic
1152003242 17:77660460-77660482 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1152310428 17:79546656-79546678 AAAAAAAAATAGAATGAGGAAGG - Intergenic
1152982742 18:294262-294284 AAAGAGAATGAGGATGAAGAGGG - Intergenic
1153204854 18:2687845-2687867 AAACAGAATGAAGGTGAGGCTGG - Intronic
1153837271 18:8975190-8975212 AAACATAAAAAGAATGAAGAAGG + Intergenic
1154099975 18:11463890-11463912 CAGAAGAATGAGTATGAGGAAGG - Intergenic
1154158600 18:11962932-11962954 ACACAAAATGCAAATGAGGAAGG - Intergenic
1154957757 18:21276065-21276087 AAACAGAATGAGAATGAGGAAGG - Intronic
1155139008 18:23026247-23026269 AAACAGAAACAGAAGGATGAAGG + Exonic
1155509437 18:26562170-26562192 AGAAAGAGTGAGAAGGAGGATGG - Intronic
1155589787 18:27413633-27413655 AAAGAGAAAGAGAAAGAGGGAGG + Intergenic
1155740759 18:29285105-29285127 ACACAGAATGAGAATTTGGAGGG - Intergenic
1156126542 18:33912221-33912243 AAAAAGATTGAGAATGAGGAAGG - Intronic
1156554798 18:38054996-38055018 AAAGAGAAACAGAATTAGGAAGG - Intergenic
1156566830 18:38200953-38200975 AAACAGGGTGAAAATGAGCATGG - Intergenic
1156612457 18:38741391-38741413 AAACATAATGAGGCTTAGGATGG + Intergenic
1156680187 18:39578822-39578844 AATCAGGATGAGAATAAGAATGG - Intergenic
1156730278 18:40185764-40185786 GAAAAGAAGAAGAATGAGGAGGG + Intergenic
1156987153 18:43361763-43361785 AAAAAGAAGAAGAATAAGGAGGG + Intergenic
1157020084 18:43770801-43770823 AAATAGGAAGAGAATTAGGAGGG + Intergenic
1157049969 18:44152035-44152057 AAACAGGAAGAGAATAGGGAAGG + Intergenic
1157177522 18:45465130-45465152 ATACAGAGTGAGACAGAGGAGGG + Intronic
1157247155 18:46064641-46064663 AAACACAGTGAGAATGTGGGAGG + Intronic
1158409240 18:57189911-57189933 AAACAGAGAGAGAAAGAGAAAGG + Intergenic
1158727046 18:59983210-59983232 TAACATAATGAGAGTGAAGAAGG + Intergenic
1158778337 18:60615014-60615036 AATGAGCAAGAGAATGAGGAGGG + Intergenic
1159115369 18:64107327-64107349 AGACAGAATGTGAAGGAGTAAGG + Intergenic
1159221270 18:65466225-65466247 AAACAGAATGAGCAAGACAAAGG - Intergenic
1159391302 18:67796041-67796063 AAGGAGAATGAGAATGAGAATGG - Intergenic
1159657351 18:71048080-71048102 AAAGAGGCTGAGATTGAGGAAGG - Intergenic
1159933083 18:74334305-74334327 AAGCAGAAGGGGAAAGAGGAAGG + Intronic
1159951866 18:74489971-74489993 AAAGAGAAAGAGAAAGAGGGAGG + Intergenic
1160964031 19:1737921-1737943 CTACAGAATGAGGATGAGGCCGG + Intergenic
1161619258 19:5289761-5289783 AAACAGCATGAGGAAGAGCAAGG + Intronic
1162157777 19:8691337-8691359 AAACAGAAAGAGAGAGAGAAAGG - Intergenic
1162215046 19:9127223-9127245 AAAGAGAAAAAGAAAGAGGAGGG - Intergenic
1162251158 19:9444693-9444715 AAAAAGAAAGAGAAGAAGGAAGG + Intergenic
1162856511 19:13472624-13472646 GAACAGAATGAGACAGAGGGAGG - Intronic
1162979319 19:14228467-14228489 AAAAAGACTGTGAAGGAGGAAGG + Intergenic
1164143759 19:22497072-22497094 AAATAGAATAAAAATGATGATGG - Intronic
1164211927 19:23106145-23106167 AAGCAGAAGGAGAAGGAGAAGGG + Intronic
1164663613 19:30004378-30004400 TAAAAGAATGAAAATAAGGAAGG - Intronic
1164718471 19:30413070-30413092 AAACAACATGGGATTGAGGAAGG - Intronic
1165168471 19:33873218-33873240 AAATAGAAGGAGAATGACAATGG + Intergenic
1166090519 19:40505685-40505707 AAAAAGAATGAAAGGGAGGAAGG + Intronic
1166095660 19:40537428-40537450 AGAGAGAATGAGAATGGTGAAGG + Intronic
1166635236 19:44445449-44445471 GAGCAGAATGAGAAAGAGGGAGG - Intronic
1166986598 19:46663797-46663819 AAAGAGAATGCAAATGAGGCCGG + Intergenic
1167205101 19:48096153-48096175 ACAAAGGATGAAAATGAGGAGGG + Intronic
1167880001 19:52449345-52449367 AGAGAGAGAGAGAATGAGGATGG - Intronic
1168209039 19:54875668-54875690 AAATAGAATCAGCATAAGGAAGG - Intronic
1168241603 19:55091725-55091747 AAACTGAGTGAGGCTGAGGAGGG + Intronic
924975249 2:167428-167450 AGACAGAGTGAAAATGAGGTTGG - Intergenic
925554672 2:5116923-5116945 AAAAAAAAAAAGAATGAGGAAGG + Intergenic
925618597 2:5768314-5768336 CAATAGAATTAGAAAGAGGAGGG - Intergenic
925865222 2:8221229-8221251 AAACAGAATGAGCAGGAGAGAGG + Intergenic
926562601 2:14434473-14434495 ATAAAGCATGAGACTGAGGAGGG + Intergenic
926645008 2:15281158-15281180 GAACAGAGTGAGAATGTTGAAGG + Intronic
926853447 2:17226586-17226608 AAAAAGAAAGAAAAAGAGGAGGG + Intergenic
927307147 2:21586621-21586643 AAAAAAAATGAAAATGTGGACGG - Intergenic
927325892 2:21804611-21804633 AAACAGAATGAGATTCAAGATGG + Intergenic
928226531 2:29453718-29453740 AAAGAGAAAGAAAAAGAGGAAGG + Intronic
928313993 2:30232138-30232160 AAACAAAAAGAAAAAGAGGAGGG - Intronic
928765690 2:34642501-34642523 AAACAGAAACAGAAAGAGAAAGG + Intergenic
928908951 2:36399245-36399267 AGACAGAATCAGAAAGAAGATGG + Intronic
929171391 2:38936393-38936415 AAACAGAAAGAGGAGGAGGAAGG - Intronic
929348366 2:40916017-40916039 AAACAAAATCAGAAAGAGTATGG + Intergenic
929379966 2:41337928-41337950 AAAGAGAGTCAGAATAAGGAAGG + Intergenic
929497028 2:42454061-42454083 AATCAGAACCACAATGAGGATGG + Intronic
929743764 2:44633463-44633485 AAACTGAAAGAGAAAGAGAAAGG - Intronic
929766445 2:44847876-44847898 AAAAAGAAGAAGAAGGAGGAGGG - Intergenic
929910954 2:46089185-46089207 ATGTAGAATAAGAATGAGGAGGG - Intronic
930258320 2:49116903-49116925 AAACAGAAATAGAATGGGGTAGG - Intronic
930806426 2:55495133-55495155 AAATAAAATGTGAAAGAGGATGG + Intergenic
931115151 2:59158030-59158052 AAAAAGAATGAAAGAGAGGAAGG + Intergenic
931787668 2:65635009-65635031 AGACAGAATGAGAATGTCTAAGG + Intergenic
932058429 2:68469958-68469980 AAACAGTTTGACAATGAGAATGG + Intronic
932429572 2:71666044-71666066 AAACAGAATGAGAAGGAGGAGGG - Intronic
933400328 2:81788481-81788503 AAACAGAAAGATACTGAGGCTGG + Intergenic
933571789 2:84022429-84022451 CAAGAGACTGAGGATGAGGAGGG + Intergenic
933860527 2:86462328-86462350 AAACATATTCAGAATAAGGAAGG + Intronic
934155460 2:89195839-89195861 AAGCAGTAGGAGAATGGGGAAGG - Intergenic
934211863 2:89986919-89986941 AAGCAGTAGGAGAATGGGGAAGG + Intergenic
934477464 2:94602959-94602981 AAACAGTATGAGAACAACGATGG - Intronic
935557605 2:104527442-104527464 AAACTGAGTGAGAGTGGGGAGGG - Intergenic
935677726 2:105610007-105610029 AAACAAAATGAAAGAGAGGAGGG - Intergenic
936388482 2:112052521-112052543 AAAAAAAAGGAAAATGAGGAAGG - Intergenic
936958679 2:118049891-118049913 AAGCAGAAAGAGAATGAGTATGG - Intergenic
936993399 2:118389186-118389208 AAACAGAATGAAATTGGAGAGGG + Intergenic
937161466 2:119766372-119766394 AAAAAGAGAGAGAAAGAGGAAGG - Intronic
937464031 2:122114205-122114227 TAACATATTGAGAATGAGAAGGG - Intergenic
937514653 2:122639567-122639589 AAACAGAATTTGAAGGGGGATGG + Intergenic
937530876 2:122825576-122825598 CTACAAAATTAGAATGAGGATGG - Intergenic
937683565 2:124670172-124670194 AAAGAGAAAGAGAGGGAGGAAGG - Intronic
938100117 2:128492811-128492833 AGAGAGAATGAGAATGAATATGG - Intergenic
938154502 2:128921411-128921433 AAAGAAAAGGAGAAGGAGGAAGG - Intergenic
938251544 2:129819658-129819680 AAAAAGAATAAAAATGAGAATGG + Intergenic
938507660 2:131903615-131903637 AAAAAGAATGTGTATGAGGGAGG + Intergenic
938665025 2:133526150-133526172 ACAGAGAAAGGGAATGAGGAAGG + Intronic
939370053 2:141287234-141287256 GAGGAGAATGAGAATGAGAATGG - Intronic
939554688 2:143660238-143660260 ATACAGAATGTGGAGGAGGAAGG - Intronic
939621608 2:144426556-144426578 TAAGAAAATGACAATGAGGAAGG - Intronic
939636771 2:144591644-144591666 GAAAAGAATGAGGGTGAGGATGG + Intergenic
939643491 2:144668666-144668688 ACACAGAATGAGGAAGTGGAGGG + Intergenic
939743556 2:145940205-145940227 AAACCAAATAAGAAGGAGGAGGG - Intergenic
939751890 2:146058299-146058321 AATTAGAATGAGAAACAGGAGGG - Intergenic
940012743 2:149072176-149072198 AAACATAGGGAGACTGAGGAGGG - Intronic
940137219 2:150451603-150451625 AAATAGAAGGAGAAGGAGGAGGG - Intergenic
940307193 2:152239328-152239350 AAACAGAATGAAAATGCTGTTGG - Intergenic
940420146 2:153471463-153471485 AAACATTGTGAGAATGTGGAAGG - Intergenic
940788305 2:158005495-158005517 CAACAGAATCAGAATCAGGGTGG + Intronic
941065965 2:160903123-160903145 AAAGAGAATAAGCATGAAGAAGG - Intergenic
941198745 2:162483010-162483032 AAGGAGAATGGGAATGAAGAAGG + Intronic
941650100 2:168083214-168083236 AAAAAAAAGGAGAATGTGGAAGG - Intronic
941691801 2:168507843-168507865 GAGAAGAAAGAGAATGAGGAAGG - Intronic
941703886 2:168636786-168636808 ACACAGAAGGAAAATGAGGTAGG - Intronic
941730043 2:168907640-168907662 AAACAGGAAGAGAAAGAGGTTGG - Exonic
941925889 2:170894316-170894338 AAAAGGAATGAGAGAGAGGATGG - Intergenic
941999714 2:171633794-171633816 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
942862259 2:180629085-180629107 GAAGAGAATGAGGTTGAGGATGG - Intergenic
943395096 2:187324001-187324023 AAAAAGAAAAATAATGAGGATGG - Intergenic
943685474 2:190813226-190813248 CAACAGCAGGAGAGTGAGGATGG + Intergenic
944210754 2:197204452-197204474 AAAGAAAATGAGAATAACGAAGG + Intronic
944289409 2:197988379-197988401 ACACAGAATGAGAAGGAAGGAGG - Intronic
944377993 2:199070681-199070703 TGACAGGATGAGAAGGAGGAAGG - Intergenic
944469296 2:200035861-200035883 AAAAACAATGAGAAAGAAGAAGG + Intergenic
945471261 2:210230036-210230058 AGACAGAGAGAGAGTGAGGAAGG + Intergenic
945946817 2:216002760-216002782 ACAAAGAAGGAGAATGGGGAGGG - Intronic
946311037 2:218882801-218882823 ACCCAGAATCAGCATGAGGAGGG + Intronic
946346677 2:219116727-219116749 AAGCAGAAAGAAAATGGGGATGG + Intronic
947388267 2:229614500-229614522 AAACAGGGTGGGAAGGAGGATGG - Intronic
947658889 2:231852059-231852081 AAAGAGAAAGAGAAAGAGGAAGG - Intergenic
948075157 2:235160269-235160291 AAACAGAAGGCAGATGAGGAGGG - Intergenic
948558597 2:238835356-238835378 AAAAAGAAGGAGAAGGAGAAGGG - Intergenic
948796021 2:240402408-240402430 AGACACAATGAGAATGAGTCAGG - Intergenic
949037675 2:241824828-241824850 AAAAAGAAGAAGAATGAGGCTGG - Intergenic
1168804865 20:666383-666405 ATACAGAAGGAGAAGGAGGGGGG - Intronic
1168919422 20:1518622-1518644 AAAGTGAATGAGAGAGAGGATGG + Intergenic
1169027906 20:2385581-2385603 CCACAGAGTGAGAAAGAGGAGGG - Intronic
1169205271 20:3736300-3736322 AATCAGAATCAGAAGAAGGATGG - Intronic
1170309017 20:14972365-14972387 AAAGAGAGTGAGAAAGAGGAAGG - Intronic
1170583590 20:17717019-17717041 AGAAAGAATGAAAATGAGGGTGG - Intronic
1170708268 20:18765846-18765868 AAACATCATTTGAATGAGGATGG + Intergenic
1170729502 20:18960997-18961019 AAACGGAGTTAGAATGAGAAGGG + Intergenic
1170788370 20:19487328-19487350 AAAAAGAAAGAGAATGAAGGTGG - Intronic
1171015526 20:21537608-21537630 AGAAAGAAAGAGAAAGAGGAGGG - Intergenic
1172569618 20:35959496-35959518 AGACAGAATGAGAAAGTGAAAGG + Intronic
1172717469 20:36976148-36976170 AAAAAGAATGAGAAATCGGATGG - Intergenic
1172937399 20:38630040-38630062 AAAAAGAAGGAGGAGGAGGAGGG - Intronic
1173345796 20:42198933-42198955 AAAAAGAAAGAGGAGGAGGATGG - Intronic
1173606645 20:44336576-44336598 AAAAAGAATGAGAAATAGAAAGG - Intergenic
1173705854 20:45110001-45110023 AATCAGAATTAGCCTGAGGAGGG + Exonic
1173884056 20:46441275-46441297 AAACAGAATGATACTGAGATGGG + Intergenic
1173897321 20:46560923-46560945 AGACAGAAAGAGAATTAGAAAGG - Intronic
1174607190 20:51769168-51769190 ATAGAGAATGAGGGTGAGGATGG - Intergenic
1175190591 20:57210061-57210083 AAACAGCCTGAGAAAGTGGAAGG - Intronic
1175319343 20:58074399-58074421 AAGCAGAAAGAGAGGGAGGAGGG + Intergenic
1175498893 20:59435408-59435430 AAACAGCAGCAGGATGAGGAGGG + Intergenic
1175538367 20:59731457-59731479 AAACATGAAGAGGATGAGGAAGG - Intronic
1175709579 20:61208547-61208569 AAAAAAGATGAGGATGAGGATGG + Intergenic
1175769463 20:61614459-61614481 CAACAGACTGAGCCTGAGGAGGG + Intronic
1175844057 20:62049421-62049443 AGACAGAATCAGAAAGAGGGCGG - Intronic
1175849766 20:62083552-62083574 AGAGAGAAGGAGAAAGAGGAGGG - Intergenic
1176523893 21:7850495-7850517 AAAGAAAATGAAATTGAGGAGGG + Intergenic
1176785826 21:13254947-13254969 AAAAAGAATGTGTATGAGGGAGG - Intergenic
1177034108 21:16020307-16020329 AGACAGAATGAGATTCAGAATGG + Intergenic
1177050052 21:16221762-16221784 AAAGAGAAAGAGAAAGAGAAAGG - Intergenic
1177099451 21:16882110-16882132 AGACACAATAAAAATGAGGAAGG + Intergenic
1177249359 21:18572220-18572242 AAGCAGGAAGAGAAGGAGGATGG + Intergenic
1177279720 21:18965384-18965406 AAATAGAATAAAAATGATGAAGG + Intergenic
1177333042 21:19685497-19685519 AACCAGAAAGAGAATCAAGAAGG - Intergenic
1177386577 21:20417205-20417227 AAACAGAAAGGGAAGGAGGTAGG - Intergenic
1177633799 21:23759939-23759961 AAAGAGACTGAGACTTAGGAAGG - Intergenic
1177833075 21:26161443-26161465 AGACAGAATAAAAAGGAGGAAGG - Intronic
1177908419 21:26999794-26999816 AAAGAGAAAGAGAATGAAGGGGG + Intergenic
1178070363 21:28958906-28958928 AAAGAGAGAGAGAAAGAGGAAGG + Intronic
1178071471 21:28972721-28972743 AAACAAGAGAAGAATGAGGAAGG + Intronic
1178291661 21:31373638-31373660 AAACAGAAAGAGAGGCAGGAGGG + Intronic
1178327341 21:31656652-31656674 AAAAAGAAAGAGAAAGAAGAAGG - Intergenic
1178496222 21:33088700-33088722 AAAAAGAAGGAGAAAAAGGAGGG + Intergenic
1178562706 21:33654025-33654047 AGAAAGAAAGAGAAAGAGGAAGG - Intronic
1178657913 21:34480507-34480529 AAAGAAAATGAAATTGAGGAGGG + Intergenic
1178947626 21:36960975-36960997 AAAGATAATGAACATGAGGATGG + Intronic
1179944240 21:44660088-44660110 AAAGAGAAAGAGAAAGAGAAGGG + Intronic
1180690093 22:17706736-17706758 AAATGAAAAGAGAATGAGGAGGG - Intronic
1181577174 22:23802435-23802457 AGACAGAAGGAAAAGGAGGAGGG - Intronic
1181896385 22:26111583-26111605 AAAAAGAAGGAGAAGAAGGAGGG - Intergenic
1181903384 22:26173436-26173458 AAACAGCATGAGAGTTTGGAAGG - Intronic
1182497376 22:30719188-30719210 AAAGAGAAGGGGAGTGAGGAGGG - Intronic
1182990072 22:34759226-34759248 GAAAAGAATGTGAATGAGAACGG + Intergenic
1183285619 22:36960890-36960912 AAGTGGAATGAGAATGAGGGTGG - Intergenic
1183594629 22:38803196-38803218 AAAAAGAAAGAGAGAGAGGAAGG - Intergenic
1184518494 22:44978284-44978306 ACACTGAAGGAGAATGATGACGG - Intronic
1184645234 22:45891631-45891653 ACACAGAACGCGAAAGAGGAAGG - Intergenic
949167470 3:959523-959545 AAACAGAATGGGGATGGGGGTGG + Intergenic
949431865 3:3985436-3985458 AAACTGAAGGAGCATGGGGAAGG - Intronic
949856951 3:8470544-8470566 AATAAGAAAGACAATGAGGATGG + Intergenic
950223647 3:11215872-11215894 AAACAGAATGTGTATGTGTAGGG - Intronic
950360793 3:12448235-12448257 AAAAAGAAAAAGAAAGAGGAAGG + Intergenic
950861339 3:16150007-16150029 GAAGAGAATGAGAATGCAGAAGG - Intergenic
950904913 3:16529464-16529486 AAACAGAATCAGACAGAAGAGGG - Intergenic
950945188 3:16938413-16938435 GGACAGAAAGAAAATGAGGATGG - Intronic
951132116 3:19060015-19060037 AATCAGGGTGAAAATGAGGAAGG + Intergenic
951274009 3:20663157-20663179 AAAGAGGATGAGAAAGAGGGTGG - Intergenic
951598282 3:24342281-24342303 AAACAGAAAGAGAATAATGCAGG + Intronic
951720232 3:25689917-25689939 AAAGAGAATGAGAATTATAAGGG - Intergenic
951750220 3:26026830-26026852 AAAGAGAATGAAAAAGAGTATGG - Intergenic
951858689 3:27226377-27226399 AGACTGAAAGAGAAAGAGGAAGG + Intronic
952047105 3:29335871-29335893 AAACAAAATGAAAAAGAGGGAGG - Intronic
952204042 3:31161626-31161648 AAACAGACTGAGAATAGGCAAGG + Intergenic
952449124 3:33414271-33414293 AAAAAGAAAGAGAGGGAGGAGGG + Intronic
952667561 3:35925077-35925099 ATAAAGAATGAGAATTAAGAAGG - Intergenic
952973963 3:38678499-38678521 AAAGAGAATCAGAATGGGAAGGG + Intergenic
953072162 3:39531501-39531523 AAGCTGAATGAGAAGGATGATGG - Intergenic
953090332 3:39718487-39718509 GATCAGAATGAGAATGGGGAAGG + Intergenic
953405183 3:42656442-42656464 AATCAGAATGAGTCAGAGGAGGG + Intronic
953563619 3:44013308-44013330 AGACAGAGGCAGAATGAGGATGG - Intergenic
955318603 3:57958847-57958869 GGACAGAAAAAGAATGAGGAAGG - Intergenic
956010825 3:64829795-64829817 AGACAGAAAGAGAAGAAGGAAGG - Intergenic
957379941 3:79414217-79414239 AAAGAGAAAGAGAAAGAGGAGGG - Intronic
957578755 3:82043505-82043527 AGAGAGAGTGAGAATGAGAATGG + Intergenic
957641786 3:82862480-82862502 AAACAGAATCAGAAAGATCAGGG + Intergenic
957957059 3:87201295-87201317 AAAGAGAACGTGAATGATGAGGG - Intergenic
957981294 3:87514767-87514789 AGAAAGAATGAGAATGAAGTTGG - Intergenic
958136195 3:89496005-89496027 AAAAAGAAAGAGAATGAGGGAGG - Intergenic
958875988 3:99617842-99617864 AAACAGAATGTAGAAGAGGAAGG + Intergenic
959340094 3:105118241-105118263 AAACAAAAAAAGAATGGGGAGGG - Intergenic
959445661 3:106435754-106435776 AGACAGAAAGAGAAAGAGAAAGG + Intergenic
959539094 3:107520628-107520650 GCACAGAATGATAATGAAGAAGG - Intergenic
959563111 3:107805159-107805181 AGACAGAATGGGAAGGAGGAAGG + Intronic
959627641 3:108471038-108471060 AAAGAAAAGGAGAAAGAGGAAGG + Intronic
960128493 3:114026978-114027000 GAACTGGATGAGAATGAAGAAGG + Intronic
960183239 3:114607597-114607619 AAAGAGTAAGAGAATGAGGCTGG - Intronic
960255969 3:115512025-115512047 AAGAAGAATGAGGATGAGAAGGG + Intergenic
960259852 3:115554545-115554567 AAAGAGAGTGAGAATGAGCCAGG - Intergenic
960270886 3:115673232-115673254 AGAGAGAAAGAGAAAGAGGAGGG + Intronic
960365167 3:116762239-116762261 GAACATTATGAGAAGGAGGAAGG + Intronic
960906441 3:122606459-122606481 AAACACAGGAAGAATGAGGAGGG + Intronic
961488250 3:127232546-127232568 ATGCAGGATGAGATTGAGGAGGG - Intergenic
961581970 3:127890781-127890803 AATCAGAATCAGAATGAGTCAGG - Intergenic
961935986 3:130584444-130584466 TTCTAGAATGAGAATGAGGAGGG - Intronic
961957944 3:130823606-130823628 AAACAGAATGCTAATGGGAAGGG + Intergenic
962300879 3:134242003-134242025 TATAAGAATGAGAATGAGGCCGG + Intronic
962390165 3:134965112-134965134 AAAAATAATGAGACTGAAGAAGG - Intronic
962410175 3:135134332-135134354 AAGCAGAATGAGTCTGAGGGTGG - Intronic
962702301 3:138011564-138011586 AAAGAGAACCAGACTGAGGAGGG + Intronic
962938075 3:140100000-140100022 AAAACGAAGGAGAAAGAGGATGG - Intronic
963414320 3:144975189-144975211 AAAAACAAAGAGAATGAGAAGGG - Intergenic
963451912 3:145492670-145492692 AAATACAATGAGAATGAAGAAGG + Intergenic
963999663 3:151754594-151754616 AAAAAGATTAAGAATAAGGATGG + Intronic
964443393 3:156735651-156735673 AATCTGAATGAGAATGTGGCCGG - Intergenic
964534490 3:157704763-157704785 AGAGAGGATGAGAATAAGGATGG + Intergenic
964737129 3:159928680-159928702 AAGCAGAATGAAGAAGAGGAAGG + Intergenic
965611630 3:170549838-170549860 AAACTGAATGACAGTGAGGATGG + Intronic
965641303 3:170831362-170831384 AAAGAGAAAGAGAAATAGGAAGG + Intronic
966168961 3:177055657-177055679 AAACAGAATAAGGATGAGGGAGG + Intronic
966669824 3:182514658-182514680 AAACAGTGTCAGAATCAGGAAGG + Intergenic
966738008 3:183205418-183205440 AAATAGAATTAGACTGGGGATGG + Intronic
966767432 3:183475938-183475960 AGACAGAAAGAGAGAGAGGAAGG - Intergenic
967501028 3:190197666-190197688 AAACAAAAAGAGAAAGAGAAAGG + Intergenic
967761453 3:193230665-193230687 AAACACAATGAGAAAAAAGAAGG + Intergenic
967823782 3:193862448-193862470 AAATAGAATTAGAGAGAGGAAGG - Intergenic
967938173 3:194746019-194746041 AAACAGAAAGAGAAACTGGAAGG + Intergenic
968604077 4:1523360-1523382 AAACAGAAGAAGAATGGGGCAGG - Intergenic
968675673 4:1877666-1877688 GAACAGAATGAGAATGGGAGTGG - Intronic
968969565 4:3786556-3786578 AAGCAGAGAGAGAAAGAGGAGGG + Intergenic
969108854 4:4828818-4828840 GGAGAGAAAGAGAATGAGGAGGG - Intergenic
969507676 4:7598282-7598304 AAACAGAGTGAGGAGGTGGAGGG + Intronic
969551233 4:7868928-7868950 AAAGAGAAAGAGAAAGAGAAAGG + Intronic
969823717 4:9740263-9740285 AAGCAGAAGGAGAAGAAGGAAGG - Intergenic
969963345 4:10969541-10969563 AAAGAGAAGGAGAGAGAGGAAGG - Intergenic
970806581 4:20042989-20043011 CAACAGAATGTGCATGAGAAAGG - Intergenic
970910045 4:21264366-21264388 AAGCAAAATGAGAATCAGAAAGG + Intronic
970918128 4:21359489-21359511 AAACCGAATGAGAGTAAGAAAGG + Intronic
971034173 4:22675142-22675164 AAAGAGAAAGAGAGGGAGGAAGG - Intergenic
971077212 4:23164142-23164164 AAACAGAATGAAGATGAGTAAGG - Intergenic
971353620 4:25874504-25874526 AAGCAGAAGGAAAATAAGGAGGG + Intronic
971394338 4:26214641-26214663 AAAAAGAAAGAGAAAAAGGAAGG + Intronic
971493044 4:27234583-27234605 AAAGGAAATGAGAAAGAGGAAGG - Intergenic
971514355 4:27467954-27467976 AAAGAAAAAGAGGATGAGGAAGG - Intergenic
971783232 4:31066475-31066497 AAACAAAATGAGAATTCAGATGG + Intronic
971823685 4:31593193-31593215 AAAAAGAAAGAGAAAAAGGAAGG - Intergenic
971928332 4:33044319-33044341 TAAAAGATTGAGAATGAGGATGG + Intergenic
972170630 4:36341474-36341496 AAACAGAATGAGAGTGAGATTGG + Intronic
972191655 4:36599882-36599904 AAAAGGAATGAGATTGTGGAGGG + Intergenic
972554318 4:40165968-40165990 AAACAGAAAGAAAATGGGAAGGG - Intergenic
972728208 4:41765300-41765322 CAAGAGAATGAGAATGAATAAGG + Intergenic
972790241 4:42364867-42364889 AGAAAGAAAGAGAAAGAGGAAGG - Intergenic
972988623 4:44797092-44797114 AAACAGAAAGAAAATGAATATGG - Intergenic
973015432 4:45131628-45131650 AAACACAAAGACCATGAGGAAGG - Intergenic
973169657 4:47124820-47124842 AAAGAAAATGAAAAGGAGGAAGG + Intronic
973339911 4:48993416-48993438 TAACAGGATCAGAGTGAGGAGGG - Intronic
973662806 4:53125419-53125441 AAAGAGAATAAGAATGAAAAAGG - Intronic
973769748 4:54195504-54195526 GAAAAGAAAGAGAATGAAGAGGG + Intronic
974274369 4:59698187-59698209 AAGGAGAATGAGGAAGAGGAGGG + Intergenic
975032762 4:69642383-69642405 AAACAGAAAAAGAAGAAGGAAGG + Intronic
975365937 4:73527562-73527584 AAACAGAAGGAGAGAGAGTAGGG + Intergenic
975470687 4:74762624-74762646 AAGGAGAATGAGAAAGAGGGTGG + Intronic
975967171 4:79987155-79987177 ACACAGAATCAGAATCTGGATGG + Intronic
976130026 4:81873915-81873937 AAACAGAATGAGAATGAAAAAGG + Intronic
976336190 4:83890326-83890348 AAAAAGAATGAAAATGGTGAAGG - Intergenic
976364424 4:84217406-84217428 AAAGAGAATGACAAAGAAGAAGG - Intergenic
976390481 4:84499664-84499686 AAATAAAATGAGAAAGGGGAGGG + Intergenic
977599077 4:98916298-98916320 AAAAAGGAAGAGAAGGAGGATGG + Intronic
978127810 4:105155377-105155399 AAACAGGGTCAGAATGATGATGG + Intronic
978588549 4:110299598-110299620 AAACAAAACGAGAAAGAGGAAGG + Intergenic
978696201 4:111583594-111583616 AGAGAGAAAGAGAGTGAGGAGGG + Intergenic
979342809 4:119547476-119547498 CAACAGAGTGAGAAAGAGAAAGG + Intronic
979350872 4:119643192-119643214 AAACATAATGATAAAGAGAATGG - Intergenic
979759720 4:124387590-124387612 AGACAGAATGAGAATGAATGAGG + Intergenic
980176867 4:129356460-129356482 CATCAGAAGGAGAAAGAGGAGGG - Intergenic
980554919 4:134391353-134391375 AAAAAGAGAGAGAATGATGAAGG - Intergenic
980784320 4:137532632-137532654 AAAGAGACGGAGAAGGAGGAAGG + Intergenic
980793838 4:137655386-137655408 AAACAGAATGAAAATCAGACAGG - Intergenic
981036571 4:140175897-140175919 CCAGAGAATGAGAATGAGAATGG - Intergenic
981530415 4:145747717-145747739 AAAGAGAAAGAGAGAGAGGAAGG - Intronic
981676839 4:147352259-147352281 ATTCAGAATGAGAAAGAGAAGGG - Intergenic
981873081 4:149509152-149509174 AAACATATTGAGGATGATGAAGG - Intergenic
982119722 4:152130993-152131015 AAAAAGGACGAGAAGGAGGAAGG - Intergenic
982129190 4:152212133-152212155 AAACAGCATGGCAGTGAGGATGG + Intergenic
982437081 4:155392169-155392191 AGACAGAGAGAGAAAGAGGAAGG + Intergenic
982471174 4:155791853-155791875 AACCAGACTGAGAAAGAGGTAGG + Intronic
982489771 4:156014962-156014984 AAACAGAATGGAAAGGATGAAGG + Intergenic
982601535 4:157457122-157457144 AAAAAGAAAGAGAAAAAGGAAGG - Intergenic
982970594 4:161980087-161980109 AAAAAGAAAAAGAAAGAGGAAGG + Intronic
983069946 4:163256147-163256169 ACACACAATGAGAATCAGAATGG - Intergenic
983313789 4:166099913-166099935 AAAGAGAATGTGAATTAGAATGG - Intronic
983625776 4:169800564-169800586 CAACAAAATGAGAGTGGGGATGG - Intergenic
983665726 4:170180295-170180317 ACACAGAAAGAGATTGACGAGGG + Intergenic
983712051 4:170730277-170730299 AAATAAAATAAAAATGAGGATGG + Intergenic
984024994 4:174532225-174532247 AAACAGATGGGGAATAAGGAAGG - Intergenic
984389673 4:179112713-179112735 AAAGAAAATGAGAAGGAAGAAGG + Intergenic
984401740 4:179274545-179274567 ATACAAAATGAGAATAAGTAAGG - Intergenic
984677622 4:182568380-182568402 AAACAGAATGAGAAGGGGCAAGG + Intronic
984767070 4:183407947-183407969 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
984791297 4:183617298-183617320 AGACAGAAAGAGAGAGAGGAAGG - Intergenic
985240180 4:187922833-187922855 AAAATGAATGGGAATGAGGCAGG + Intergenic
985764950 5:1772451-1772473 ACACAGACTGAGAATAATGAAGG - Intergenic
985934473 5:3085156-3085178 AAACAGACTTATAATGAGCAAGG + Intergenic
986070372 5:4277127-4277149 AAACAGAAAGATAAAGAAGAAGG + Intergenic
986232350 5:5877898-5877920 AGATAGAATGAGAAAGAGTAGGG - Intergenic
986777485 5:11031119-11031141 AAACATAAAGTGGATGAGGAGGG + Intronic
986879026 5:12147514-12147536 AAAAAGAAAGAGAAAGAGAAAGG - Intergenic
986995780 5:13605526-13605548 AAGAAGAATGAGAGTAAGGAGGG + Intergenic
987097201 5:14560581-14560603 GAGCAGATTGTGAATGAGGAGGG - Intergenic
987731626 5:21780959-21780981 GAAAACAAAGAGAATGAGGATGG + Intronic
987741263 5:21912261-21912283 AAACAAAATGAGAAACAGAATGG + Intronic
987785440 5:22492981-22493003 AAACAGAGAGAGATTGAGAAAGG - Intronic
987788287 5:22530492-22530514 AAACAGAATTTTAATGAGGTAGG - Intronic
987955078 5:24728748-24728770 AAAGAGAAAGCGAATGAGGGTGG - Intergenic
988179950 5:27777691-27777713 AGAAAGAATGAGAAGAAGGAAGG + Intergenic
989686684 5:44096872-44096894 AAAAAAAATGGCAATGAGGAGGG - Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990252591 5:53931732-53931754 AAACACAATGAGAATAAGTAGGG + Intronic
990663163 5:58041755-58041777 AAAGAGACTGAGAAGGAGCAGGG + Intergenic
991640702 5:68748983-68749005 AAATAAAATGAGATTGAGGTAGG + Intergenic
991651725 5:68862459-68862481 AAACAGCAGTAGAAAGAGGATGG - Intergenic
991933159 5:71775227-71775249 ACAGAGAAAGAGAATAAGGAGGG - Intergenic
992149756 5:73891386-73891408 AAAGAGACTGAGAAGGAGGGAGG - Intronic
992358968 5:76016410-76016432 ACATGGAATGAGGATGAGGAGGG + Intergenic
992676943 5:79114447-79114469 GAAGAGAATGAAAATGAGGGAGG + Intronic
992795834 5:80254680-80254702 AGAGAGAAAGAGAATGAGAATGG - Intronic
992865635 5:80954448-80954470 ACACAGCAGGAGAATCAGGAAGG + Intergenic
993004154 5:82412771-82412793 ACACAGTATGAGGTTGAGGAGGG - Intergenic
993179918 5:84539510-84539532 AAAGAGAAAGAGAAAGAGAAAGG + Intergenic
993292968 5:86099187-86099209 AAACACATTGAGAATAAGAATGG - Intergenic
993415731 5:87627766-87627788 AAAATGAAACAGAATGAGGAGGG + Intergenic
993491463 5:88556579-88556601 AGAGAGATTGAGAATAAGGAGGG - Intergenic
993491850 5:88561381-88561403 ATACTGAATGAAAAAGAGGAAGG + Intergenic
994038550 5:95230452-95230474 AAGCAGAATGAGAATAAAGATGG - Intronic
994359151 5:98830689-98830711 AAACACAATCAGAATGATAAAGG + Intergenic
994874976 5:105409705-105409727 TAACATAATCAGAATGAGTAAGG - Intergenic
995039929 5:107576202-107576224 AAAGAGTATGATAATGATGATGG - Intronic
996116192 5:119622305-119622327 AAACAGAAAGAGAAGAAAGAAGG - Intronic
996445790 5:123548746-123548768 AAAAAAAATGATAATAAGGAAGG + Intronic
996909358 5:128637438-128637460 AGACAGAAAGAGAAAGAGGGAGG + Intronic
996942280 5:129022657-129022679 TTACAGAATAAAAATGAGGAGGG + Intronic
997037089 5:130205833-130205855 AGATGGAATGAGAAGGAGGAGGG - Intergenic
997722493 5:136090526-136090548 AAAGTGAAAGAGAATGAGGCCGG + Intergenic
998408698 5:141890639-141890661 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
998537806 5:142950982-142951004 AAAGAGAAAGGGAAAGAGGAAGG - Intronic
998597683 5:143550767-143550789 AAAAAGAAGGAGGAAGAGGAGGG - Intergenic
998775239 5:145592316-145592338 AAGGAGAATGACACTGAGGAAGG + Intronic
998918756 5:147044168-147044190 ACTCAACATGAGAATGAGGAGGG - Intronic
998936720 5:147236795-147236817 AATCAGAAAGAGAAAGAGGAAGG - Intronic
999090460 5:148931729-148931751 AAAGAGAATGAGAGGGAGGGAGG - Intronic
999115265 5:149157433-149157455 ATAAAGAATCAGAAGGAGGAAGG - Intronic
1000111991 5:158117054-158117076 AAAGAGAAAGAGGAAGAGGAAGG - Intergenic
1000127646 5:158262327-158262349 AAAGAGCATGAGAAAGAGGGAGG - Intergenic
1000652037 5:163830231-163830253 ACACAGTGTGAGAAGGAGGAGGG + Intergenic
1000814297 5:165900932-165900954 AAAAAGAAAGGGAATGAAGATGG - Intergenic
1000898953 5:166890194-166890216 CCACAGAATGAGAATGATGATGG + Intergenic
1001108369 5:168875126-168875148 AGAAAGAATGAGAGGGAGGAAGG + Intronic
1001111977 5:168904116-168904138 GAGCGGAGTGAGAATGAGGAGGG - Intronic
1002100023 5:176852980-176853002 AAACAGACTGGGAAAGGGGAGGG + Intronic
1002621313 5:180490491-180490513 AATCAGCATGAGAATCAGCACGG + Intergenic
1002969140 6:1996162-1996184 TAGAAGAATGAGAAAGAGGAAGG - Intronic
1003145740 6:3508847-3508869 AAACAGAAGAAAAATGAGGAGGG - Intergenic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003513466 6:6800412-6800434 AGACAGAAAGAGAAAGAGAAAGG - Intergenic
1003714239 6:8628617-8628639 AGACAGAAAGAGAAGAAGGAAGG - Intergenic
1004298102 6:14432694-14432716 AAACAGAATGTTAAGGATGAAGG + Intergenic
1004727994 6:18329365-18329387 AAAAATAATGAGCATGAGGCAGG + Intergenic
1004791052 6:19026892-19026914 AAATATGATGGGAATGAGGATGG + Intergenic
1004798494 6:19116728-19116750 AACCAAAATTAGAAGGAGGAAGG + Intergenic
1005170160 6:22974950-22974972 AAACAGGTTGATAATGAGGCAGG + Intergenic
1005419064 6:25630466-25630488 AAACAGAAAGAGAATGGTTAGGG + Intergenic
1005471127 6:26163689-26163711 AAAAAGAAAGAGAAAGGGGAAGG + Intronic
1005495266 6:26382828-26382850 AAAGAAAAAGAGAATGAGAAAGG + Intergenic
1005631067 6:27708455-27708477 AAACAGAAAGAGAGGAAGGAAGG - Intergenic
1006043853 6:31276872-31276894 AAACAAAAAGAAACTGAGGAGGG + Intronic
1006932051 6:37694477-37694499 AAACAGCATGAGAGTGAAGGCGG - Intronic
1006932900 6:37698153-37698175 AAAGAGAAAGAGAAAGAGAAAGG - Intronic
1007271423 6:40640436-40640458 AGAAAGAATGAGAAGGAGGGAGG - Intergenic
1007380655 6:41488303-41488325 AGCCAGAAGGAGACTGAGGAGGG - Intergenic
1007405529 6:41634031-41634053 CAACACAATGAGACAGAGGAGGG + Intergenic
1007470547 6:42087465-42087487 AAATGGAATGAGAAGGAAGAAGG - Intergenic
1008326394 6:50187350-50187372 AGGCAGAATGACAATGAGGATGG - Intergenic
1008440329 6:51525440-51525462 ATTCAGAATGAGAAAGAGAAGGG + Intergenic
1008443147 6:51556020-51556042 GAACAGAAAGGGAAGGAGGAAGG + Intergenic
1008666850 6:53725114-53725136 AAACAGAGTGAGTTTAAGGAAGG - Intergenic
1009167347 6:60357009-60357031 AAACAGCATTAGACTGAGGGAGG - Intergenic
1009671258 6:66753889-66753911 AAAGAGAGAGAGAATGAGGGAGG + Intergenic
1009966687 6:70585720-70585742 AAACAGAATGCTGATGAGTATGG + Intronic
1010178816 6:73060305-73060327 AACCAGAGTGAGAATGAAGTTGG - Intronic
1010181909 6:73096394-73096416 AAGCAGAATGAGAGAGAGCATGG + Intronic
1010853492 6:80807489-80807511 AGTTAGTATGAGAATGAGGAAGG + Intergenic
1011096606 6:83673165-83673187 TAACAGAAAGAGAAGAAGGAAGG - Intronic
1011492852 6:87910492-87910514 ACACAGAATCAGCAGGAGGATGG + Intergenic
1011749400 6:90440009-90440031 AAAAAGAAAAAGAAAGAGGAAGG - Intergenic
1011902389 6:92314925-92314947 AGAGAGAAAGAGAGTGAGGAGGG - Intergenic
1012011006 6:93785459-93785481 AAACAGAAAGAGAAAGAAAATGG + Intergenic
1012062407 6:94505453-94505475 AAATAGCTTGAGACTGAGGATGG + Intergenic
1013674563 6:112443678-112443700 AAACTGAATGAGAAGGAAAAGGG - Intergenic
1014032157 6:116718183-116718205 AAACAGAGTAAAAATGAAGAAGG - Intronic
1014717476 6:124883334-124883356 AAACAGTGTGAGGATGAGAATGG - Intergenic
1014896174 6:126902744-126902766 AAATAGAATTAGAAAGAGAAAGG + Intergenic
1015135688 6:129867321-129867343 CAACAGAAAGAGAACCAGGAGGG + Intergenic
1015167533 6:130214770-130214792 AGAGAGAATTAGAATGAGAAGGG - Intronic
1015312227 6:131778607-131778629 AGACAGACTGAGGATGAGAAGGG + Intergenic
1015313300 6:131788969-131788991 ACACAGAATGATTTTGAGGAAGG - Intergenic
1016010233 6:139131934-139131956 AAACAAAATGAAAAGGAGGAAGG - Intergenic
1016050436 6:139524772-139524794 CAACACAAGGAAAATGAGGAAGG - Intergenic
1016257372 6:142123987-142124009 AAATATAATGAGAACGAAGATGG + Intergenic
1016476088 6:144430354-144430376 AAACAGAATGAGATTAAATATGG - Intronic
1016703996 6:147085537-147085559 AAAAAGAATGGGAACGAGGAGGG - Intergenic
1017256868 6:152343453-152343475 AAAAAGAAAGAGAATGGGGCCGG - Intronic
1017586939 6:155936875-155936897 AAATAGAGAGAGAAGGAGGAGGG + Intergenic
1017691321 6:156968495-156968517 AAAGACGATGAGAATGATGATGG - Intronic
1018037315 6:159892536-159892558 CAACTGAATGGGAATGTGGAAGG + Intergenic
1018186877 6:161273340-161273362 AACCAAAATGAAAGTGAGGAGGG + Intronic
1018735206 6:166682567-166682589 GAACAGAGTGAGAGGGAGGAGGG + Intronic
1018882887 6:167903141-167903163 ATAGAGAATGAAAATGAGAAAGG - Intronic
1019820995 7:3242592-3242614 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1020190027 7:5988450-5988472 AGGGAGAATGAGAATGAGGCAGG + Intronic
1020292895 7:6736225-6736247 AGGGAGAATGAGAATGAGGCAGG - Intergenic
1020822752 7:12990625-12990647 AAATAGAAAGATAATGAGAAGGG + Intergenic
1020838091 7:13179922-13179944 AAACAGCCTGAGAATAATGATGG + Intergenic
1021079744 7:16349724-16349746 AAAGAGAATGAGAAAGAGTACGG + Intronic
1021128278 7:16880123-16880145 AAAGAGAGAGAGAAAGAGGAAGG - Intronic
1021394347 7:20128981-20129003 AAAAAGAATGAGAAAGAGAAAGG + Intergenic
1021638038 7:22710628-22710650 AAACAGAATGAAAAGGGGTAAGG + Intergenic
1021739592 7:23672598-23672620 AAATAGAATGTGATGGAGGAGGG + Intergenic
1022477822 7:30723308-30723330 GAACAGATTGAAAATGAGGCAGG - Intronic
1023028085 7:36070022-36070044 AAAAAGAAGAAGAAGGAGGAGGG + Intergenic
1023149127 7:37183190-37183212 GCACAGAAGGAGAAGGAGGAAGG + Intronic
1023188993 7:37559153-37559175 AAAAAGAAAGAGAAGGAGGAGGG - Intergenic
1023218482 7:37892904-37892926 TAAAAGAAAGAGAAAGAGGAAGG - Intronic
1023251116 7:38262129-38262151 AAACAAAATGATCAGGAGGAAGG + Intergenic
1023293008 7:38686920-38686942 GAACAGAAAGAAAATGAGGCTGG + Exonic
1023399559 7:39782290-39782312 AAACAGAGTGAATATGTGGAAGG - Intergenic
1023550906 7:41369161-41369183 AAAAAGAAAGAGAAAGAAGAAGG - Intergenic
1023654958 7:42410068-42410090 AAACAGAAGGGGAAAGAGAAGGG - Intergenic
1024167055 7:46745841-46745863 CAACAGAATAAGAAAGAGGCAGG + Intronic
1024355920 7:48413225-48413247 AGACAGAAGCAGAAAGAGGAGGG - Intronic
1024403917 7:48955424-48955446 AAACAGAAAGAAAATCAGCAAGG + Intergenic
1024454360 7:49586198-49586220 AAACAGTATGAGTAGGAGAAAGG + Intergenic
1024633961 7:51271637-51271659 AAACTGAAAAAGACTGAGGAGGG + Intronic
1025091406 7:56067125-56067147 AAACAGCATGAGCAGAAGGATGG + Intronic
1025221428 7:57113182-57113204 AATCAGAATGAAAATGAATACGG + Intergenic
1025632214 7:63284852-63284874 AATCAGAATGAAAATGAATACGG + Intergenic
1025650345 7:63461377-63461399 AATCAGAATGAAAATGAATACGG - Intergenic
1025833851 7:65077625-65077647 AAACAGCATGAGCAGAAGGATGG + Intergenic
1025903622 7:65767145-65767167 AAACAGCATGAGCAGAAGGATGG + Intergenic
1026529522 7:71185046-71185068 AAGCAGAAGGAGGAGGAGGAGGG - Intronic
1026990182 7:74580686-74580708 GAACAGAATGAGCAGGAGGGGGG + Intronic
1027109898 7:75429160-75429182 AAACAGAATAAGACTGCAGAGGG + Intronic
1027176430 7:75906706-75906728 AAAGAAAATGAGAAACAGGAGGG - Intronic
1027223645 7:76230627-76230649 CAACAGATTGAGAGTCAGGAAGG + Intronic
1027636362 7:80680293-80680315 ATATAGAAAGTGAATGAGGAAGG + Intergenic
1027971735 7:85091509-85091531 AAAAAGAGTGAGAAAGAGGGAGG + Intronic
1028005634 7:85563443-85563465 ACACAGACTGAGAATGAATATGG - Intergenic
1028057961 7:86272178-86272200 AAAGCGAAAGTGAATGAGGAAGG - Intergenic
1028478551 7:91278355-91278377 GTAAAGAATGAGAATGTGGAAGG - Intergenic
1028505478 7:91565919-91565941 AGCCAGACTGAGAAGGAGGAGGG - Intergenic
1028696374 7:93717712-93717734 AAAGAGAAAGAAAAGGAGGAAGG + Intronic
1028746099 7:94328396-94328418 AAAAAGAATGGAGATGAGGAAGG + Intergenic
1028815971 7:95145368-95145390 AATAAGCATGAGAATGAGCATGG + Intronic
1028962711 7:96767526-96767548 AAACAGGATGAGAAAGAGAGAGG + Intergenic
1028994146 7:97081249-97081271 AAACAAGTTGAGAATCAGGAAGG - Intergenic
1029010142 7:97251382-97251404 AAACAAAATGAGAATTACAAAGG - Intergenic
1029162394 7:98561948-98561970 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1029377788 7:100191043-100191065 AAACAGAATTATAAGGAGAAAGG - Intronic
1029476136 7:100785959-100785981 GAAGAGAAAGAGAGTGAGGAGGG - Intronic
1030190535 7:106806112-106806134 AAATGGAAGGAGAAAGAGGAGGG + Intergenic
1030607812 7:111656896-111656918 AAGGAGAATGAAAATGAGCAGGG + Intergenic
1030828026 7:114185986-114186008 AAAGAGAAAGAGAAAAAGGAGGG + Intronic
1031483625 7:122304973-122304995 AAGCAGATTGAGAATTAGAAAGG - Intronic
1031732992 7:125320864-125320886 ATAGAGAAAGAGAGTGAGGAGGG - Intergenic
1032099190 7:128959014-128959036 AAAAAGAAAGAAAATGAGAAAGG + Intronic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032210079 7:129905665-129905687 ACACAGAAAGAGAAGGAAGAGGG + Intronic
1032655831 7:133928743-133928765 AAAAAGCATTAGAAAGAGGAAGG + Intronic
1032709803 7:134451653-134451675 TACCAGAATGAGAATGAGGTGGG - Exonic
1033020479 7:137719492-137719514 AAGCAGAATGATATTGAAGAAGG + Intronic
1033208792 7:139444992-139445014 AAACACAAAGAGATTCAGGATGG + Intergenic
1033219129 7:139516499-139516521 AAGCAGCCTGAGAATGAGGCTGG + Intergenic
1033555619 7:142486457-142486479 AAACATTAGGAGAAGGAGGAGGG - Intergenic
1033806872 7:144964175-144964197 AAACAGTATGAAAATCAGTAGGG - Intergenic
1033889594 7:145994978-145995000 AAAGAGAAGGAGGAGGAGGAGGG - Intergenic
1034193589 7:149229144-149229166 TAGGAGAATGAGATTGAGGATGG + Intergenic
1034354421 7:150441866-150441888 AAGCAGAAGGAGAAGGAGAAGGG - Intergenic
1034978920 7:155463489-155463511 AAAGAGAAGGAGGAGGAGGAAGG - Exonic
1035111098 7:156482532-156482554 AGAAAGAAAGAGAAAGAGGAAGG + Intergenic
1035712692 8:1730636-1730658 ACACAGAATATGAATGAGCACGG - Intergenic
1035750494 8:1992630-1992652 AAACAGTATGAAAATAAGGATGG - Intronic
1035993199 8:4515628-4515650 AAACAAAATAAAAATGAGAACGG + Intronic
1036061838 8:5331520-5331542 AAAGAGAAAGAGAAAGAGAAAGG - Intergenic
1036156418 8:6346414-6346436 AAAAAGAAAGAAAATGAGGGCGG + Intergenic
1036208661 8:6824404-6824426 AGACATAATGAGAATGTGAATGG + Intronic
1036502498 8:9326381-9326403 AAAAAGAGAGAGAATGAGGGAGG - Intergenic
1036582332 8:10086920-10086942 AATGAGAATGAGAATGAGAATGG + Intronic
1037328936 8:17724725-17724747 CAAGAGAATGGGCATGAGGAGGG - Intronic
1037454708 8:19051993-19052015 AAAGTGATGGAGAATGAGGAAGG + Intronic
1037958183 8:23074916-23074938 AGAGAGAAGGAGAATGAGAAGGG - Intergenic
1038284992 8:26198582-26198604 AAAAAGAAGGAGGAGGAGGAGGG - Intergenic
1038848017 8:31247806-31247828 AAACTGAAGGAGAAATAGGATGG + Intergenic
1038884028 8:31643126-31643148 GGAAAGAATGAGAATGAGAATGG + Intronic
1039231858 8:35457385-35457407 CAACAGAATGACAATGACCAGGG + Intronic
1039674505 8:39646885-39646907 AAGTAGAAGGAGAATGAAGAGGG + Intronic
1039757687 8:40540806-40540828 AAACAGAATCAGAATCAGAGAGG - Intronic
1039956689 8:42212920-42212942 AGACAGAATGAGCACAAGGAGGG - Intergenic
1040079746 8:43274824-43274846 AATGAGAATGAGGAGGAGGAGGG - Intergenic
1040552173 8:48445977-48445999 AAACAGAATGAGCATGAGGCTGG - Intergenic
1040564804 8:48555894-48555916 CAAAAGAAAGAGAAAGAGGAGGG - Intergenic
1040662503 8:49591983-49592005 AGACAGAAAGAGAAAGAGAAAGG + Intergenic
1040739259 8:50552536-50552558 GAACAGACTGAGAATGAGGGTGG + Intronic
1040770548 8:50970129-50970151 CCACAGAATGAGAAGGGGGAAGG + Intergenic
1040974635 8:53176461-53176483 AAAGGGGATGAGAAGGAGGAGGG + Intergenic
1041264610 8:56052169-56052191 ACACAGAATGAGCCTGGGGATGG + Intergenic
1041267603 8:56080326-56080348 AAAAAGAAGAAGAAGGAGGAGGG + Intergenic
1041269033 8:56092806-56092828 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1041313468 8:56539160-56539182 GAACAGAATGGGGAGGAGGAGGG + Intergenic
1041330488 8:56719134-56719156 GAAGAGAATGGGAAAGAGGAGGG - Intergenic
1041592030 8:59598828-59598850 AAACAAAAAGGGAATCAGGAGGG - Intergenic
1042229298 8:66540568-66540590 ACACAGGATGGGAATCAGGATGG - Intergenic
1042361407 8:67887467-67887489 CAACATATTGAGAAGGAGGATGG - Intergenic
1042816555 8:72883654-72883676 AAAGAGAATGGGATTGGGGAGGG - Intronic
1042839873 8:73112727-73112749 AAAGAGAAAGAGAAAGAGGGAGG - Intronic
1042934694 8:74046886-74046908 AAAAAGAATGAGAATGAGAATGG - Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1042981022 8:74528267-74528289 AAACCCAGTGAGTATGAGGAAGG + Intergenic
1043097225 8:75990450-75990472 AAAAAGAAAGAGAGAGAGGAAGG + Intergenic
1043500112 8:80845182-80845204 AATCAGTATAAGAGTGAGGAAGG - Intronic
1043804410 8:84653416-84653438 AAACAGAATGAGCAAAAGAAAGG - Intronic
1043917593 8:85940538-85940560 CAACAGAGAGAGAATGAGGAAGG + Intergenic
1043967711 8:86497754-86497776 AAACATAATCAGAATGACAATGG + Intronic
1043973798 8:86563102-86563124 AAACAGAACAAGAGTGAGCAAGG + Intronic
1044104011 8:88178951-88178973 AAAGAGAATGAAAAAGAGAACGG + Intronic
1044140794 8:88649082-88649104 AAACAGAAACAGAATGAATAGGG - Intergenic
1044236331 8:89835014-89835036 ATACAGAATGAGGAGGAGAAAGG + Intergenic
1044357279 8:91237593-91237615 AAAAAGAGTGAAAATGAGGCAGG - Intronic
1044678475 8:94753237-94753259 AAAAAGAATAAGTATGAAGAAGG + Intronic
1045576851 8:103431768-103431790 AAACAGAATGAGTGTTAGGTAGG - Intronic
1045784618 8:105905621-105905643 AAACAGAAGCAAAATGAGGAAGG + Intergenic
1045811591 8:106227144-106227166 GCACAAAATGAGAGTGAGGAGGG - Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046230123 8:111345290-111345312 AAAAAGAAGAAGAAAGAGGAAGG + Intergenic
1046334981 8:112773489-112773511 AAAAAGCATGAGAATTAGAAAGG + Intronic
1046744199 8:117859848-117859870 ACATAGAATGAAAATGAGGCTGG + Intronic
1046817553 8:118601458-118601480 AAATAGAATAATAATGAGGAGGG - Intronic
1046930416 8:119836403-119836425 AAACAGTATAAGAAGGAGAAAGG + Intronic
1046978576 8:120311665-120311687 ATACAGAATAAGAATTTGGAAGG + Intronic
1047123408 8:121931796-121931818 AAACAGCAAGAAAATGAGAAAGG + Intergenic
1047244651 8:123130472-123130494 AAAGAGAATGAGAAAGCTGAGGG - Intronic
1047883887 8:129226818-129226840 AAATAGAATGAGGAAGAGAAAGG + Intergenic
1048013486 8:130477417-130477439 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048162886 8:132037382-132037404 ACACACAATGAGAGTGGGGAGGG - Intronic
1048196613 8:132336704-132336726 ATACAGAATAATTATGAGGAGGG - Intronic
1048383741 8:133892100-133892122 AAACAAAATCAGCAAGAGGATGG - Intergenic
1048383905 8:133893251-133893273 AAACAGAGAGAGAAGGAGGGAGG + Intergenic
1048574617 8:135680960-135680982 AGAAAGAATGAGACTGAGAAAGG + Intergenic
1048778592 8:137976224-137976246 AAACAGAAAGAGAGAAAGGAAGG + Intergenic
1048843225 8:138582901-138582923 AAAAGGAGTGAGAATGAGGAAGG - Intergenic
1048852224 8:138656186-138656208 AAACAGAAGGAGAGTAGGGATGG - Intronic
1049048173 8:140169541-140169563 AAACAGAATGCGGATGTGGAAGG + Intronic
1050096563 9:2073537-2073559 AAAAAGAGTGAGGAAGAGGAGGG - Intronic
1050457076 9:5844714-5844736 AAACAAAAAGGGGATGAGGAGGG - Intergenic
1050632127 9:7571274-7571296 AGAGAGAAAGAGAATGATGATGG + Intergenic
1051072405 9:13187562-13187584 AAAAAGAAAGAGAAGGAGGAGGG - Intronic
1051106509 9:13587024-13587046 AGAGAGAAGGAGAATGGGGAGGG - Intergenic
1051149055 9:14061123-14061145 AAACAGCATGAGAAATAGCATGG - Intergenic
1051428605 9:16959871-16959893 AAACAGAGGGAGAAGCAGGAGGG - Intergenic
1051662117 9:19435409-19435431 ACACAGAAGGAAAAAGAGGAAGG + Intronic
1051860341 9:21617389-21617411 ACACAGGATGAGAATGATGGGGG + Intergenic
1051946713 9:22577996-22578018 AAACACAATTAGAATGACAAAGG - Intergenic
1052251310 9:26400868-26400890 AAACAAACTGAGAATAACGAAGG + Intergenic
1052261265 9:26519157-26519179 AAATAGAATGGGAATGAAAAAGG - Intergenic
1052406346 9:28065808-28065830 AATGAGAATGAGAATGATGGTGG + Intronic
1052852505 9:33386597-33386619 AAACAGTATGAGAACAACGATGG + Intronic
1053116521 9:35509051-35509073 AATCAGAATCAGAATGAGGCTGG + Intronic
1053330434 9:37201346-37201368 GAAAAGAATGAGAAGGTGGAAGG - Intronic
1053680603 9:40483148-40483170 AAACAGTATGAGAACAACGATGG + Intergenic
1053930592 9:43111459-43111481 AAACAGTATGAGAACAACGATGG + Intergenic
1054283109 9:63141787-63141809 AAACAGTATGAGAACAACGATGG - Intergenic
1054293686 9:63318663-63318685 AAACAGTATGAGAACAACGATGG + Intergenic
1054391709 9:64623152-64623174 AAACAGTATGAGAACAACGATGG + Intergenic
1054504018 9:65893176-65893198 AAACAGTATGAGAACAACGATGG - Intronic
1054820280 9:69515227-69515249 AGAAAGAATGGGAATGTGGAGGG - Intronic
1055811603 9:80155323-80155345 ACAAAGAATGAAAGTGAGGAGGG - Intergenic
1055891667 9:81130577-81130599 AAACAGAATGACAGCAAGGAGGG + Intergenic
1055897712 9:81198529-81198551 AAAAAGGAGGAGAAGGAGGAAGG + Intergenic
1055985159 9:82051349-82051371 AGAGAGAATGAAAAAGAGGAGGG - Intergenic
1056112283 9:83407917-83407939 AAAGAGAAAGAGAAAGGGGAGGG - Intronic
1056302040 9:85251874-85251896 AAACAGAATGATATGAAGGAGGG + Intergenic
1056548887 9:87635385-87635407 AAGCAGAATGCGAGTGAGGTGGG + Intronic
1056652637 9:88481105-88481127 GAAAATAATGAGAAAGAGGATGG - Intergenic
1057108743 9:92446843-92446865 AAACAGAAAGAGAGTGAGGGAGG + Intronic
1057869202 9:98706122-98706144 AAAAAGAAGGAGGAGGAGGAGGG + Intronic
1057884265 9:98817789-98817811 AGAAATAATGAGATTGAGGAGGG + Intronic
1058009590 9:99961751-99961773 AATCAGAATTGGAATGAGAAAGG + Intronic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058987907 9:110225797-110225819 AGAGAGAAGGAGAGTGAGGAGGG - Intergenic
1059181330 9:112215340-112215362 TAACTGAAAGAGTATGAGGAGGG - Intergenic
1059552787 9:115246529-115246551 AAACAGAAAGAAAAGGATGAGGG - Intronic
1059605704 9:115832820-115832842 AAAGAGAAAGAGAATGAAGCGGG - Intergenic
1059812641 9:117872979-117873001 AAACAGAACAGGAATGGGGAAGG + Intergenic
1059918316 9:119129117-119129139 AATAAGAATGAGGAGGAGGAGGG + Intergenic
1059953740 9:119494660-119494682 AAAGAAAGTGAGAATGAGGCAGG + Intergenic
1060592741 9:124829202-124829224 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1060839516 9:126782661-126782683 AAAAGGAGTGAGAATGGGGAGGG + Intergenic
1060962883 9:127693605-127693627 GATCAGAATGAGAATGATGGGGG - Intronic
1061013948 9:127971349-127971371 AAGCAGAATGGAAAGGAGGAGGG - Intronic
1061082732 9:128381989-128382011 AAAGAGAAAGAGAAGGAGGGAGG + Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062638357 9:137503420-137503442 AGAAAGAAGGAGAATGAGGAGGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062692889 9:137853564-137853586 ATACACAATGAGAAAGAGAAAGG - Intronic
1062692890 9:137853614-137853636 ATACACAATGAGAAAGAGAAAGG - Intronic
1185688218 X:1948093-1948115 AAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1185688507 X:2133632-2133654 AAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1186034478 X:5406171-5406193 AAAGAGGAGGAGAAGGAGGAAGG + Intergenic
1186068292 X:5790140-5790162 AGAAAGAAAGAGAAAGAGGAAGG + Intergenic
1186141692 X:6581352-6581374 AAACAGATTCACAATGAGCAAGG - Intergenic
1186683318 X:11898404-11898426 AGACAGACTGATAAAGAGGAGGG - Intergenic
1187254748 X:17632145-17632167 AAAGAGAAGGAGAATGTGGAAGG + Intronic
1187416138 X:19094900-19094922 AAAAAGAAGGAGAAAGTGGACGG - Intronic
1187802595 X:23080757-23080779 AAAGAGAATATGTATGAGGATGG - Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188466171 X:30483713-30483735 AAACAGAGAGAGAAAGAGGGTGG + Intergenic
1188796360 X:34471218-34471240 GAACAGAATGAGATTGGGCAGGG + Intergenic
1189013757 X:37074137-37074159 AAAAAGAAAGAGAATGAAGCTGG + Intergenic
1189314010 X:40040907-40040929 TAAAAGAAGGAGAAGGAGGAGGG - Intergenic
1189505590 X:41610590-41610612 AAACAGAATGAGAATGACTTTGG - Intronic
1190636729 X:52442133-52442155 AGAAAGAAAGAGAATGAGAAAGG - Intergenic
1190735767 X:53255249-53255271 AAAGAGAATGAGAAAGGAGAAGG + Intronic
1190753551 X:53381888-53381910 AAAGGGGAGGAGAATGAGGAAGG + Intronic
1190937384 X:55008912-55008934 AAACAGAATGAGAAAGAGGAAGG - Exonic
1191713033 X:64173069-64173091 AAACAGTAAGAGAATGAAAATGG + Intergenic
1192286717 X:69746139-69746161 AGAAAGAAAGAGAATGAGAAAGG - Intronic
1192619551 X:72663938-72663960 AAAGAGAAAGAGAAAGAGAAAGG + Intronic
1192948027 X:75986628-75986650 CAAGAGAGTGAGAATAAGGAAGG + Intergenic
1193145900 X:78075208-78075230 AAAGAGAATGAAAAGGGGGAAGG + Intronic
1193427726 X:81359746-81359768 AAACACAATCAGAATGACAAAGG - Intergenic
1193448037 X:81629295-81629317 AGAAAGAAAGAGAGTGAGGAAGG - Intergenic
1193588198 X:83353661-83353683 AAAAAGGAGGAGAATGAGAATGG + Intergenic
1193722406 X:85003003-85003025 AAACAGTATGGGAATGAGGTGGG - Intergenic
1193763781 X:85499942-85499964 AAACAAAGTGAGAAGGAGAAAGG + Intergenic
1193763818 X:85500633-85500655 AAAGAGAAGGAGAATGAGTTTGG + Intergenic
1194638034 X:96369670-96369692 AGATAGCATGACAATGAGGAAGG - Intergenic
1194903231 X:99541263-99541285 AAACCAAAAGAGAATGAGGGTGG + Intergenic
1195018614 X:100802738-100802760 AAAGAGAATGAGAAAGAAAAGGG + Intergenic
1195101609 X:101560594-101560616 AAAAAGAATGAGAAGGAACAAGG - Intergenic
1195430784 X:104786892-104786914 AATGAGAATGAGAATGAGAGAGG - Intronic
1195930128 X:110066096-110066118 AAGAAGAATGAAAATGAGAAAGG - Intronic
1195965185 X:110423343-110423365 AAAAAGAAAAAGAAAGAGGAAGG + Intronic
1196039828 X:111190194-111190216 AAACACAAGCAGAGTGAGGAGGG + Intronic
1196082036 X:111642860-111642882 AAACAGACTGATAATATGGAAGG - Intergenic
1196164427 X:112522904-112522926 AAACAGACTAAGAAGGAGAAAGG - Intergenic
1196472421 X:116043627-116043649 TACCAGAATGAGAATGAGTCAGG + Intergenic
1196591476 X:117490293-117490315 TAAGAAAATGACAATGAGGATGG - Intergenic
1196760751 X:119198486-119198508 AAGAAGAATGAGAATGAGCAAGG + Intergenic
1197329975 X:125141639-125141661 TAACAGAAGAGGAATGAGGAAGG + Intergenic
1197719973 X:129738593-129738615 AAAAAGGAGGAGGATGAGGAGGG + Intergenic
1197849694 X:130844405-130844427 AAAGAGAAAGAGAAGGAGGAAGG + Intronic
1198004604 X:132480057-132480079 AAACAGAATAAGATCGAGGCTGG - Intronic
1198150180 X:133900631-133900653 CAACAAAATGATAAGGAGGAAGG + Intronic
1198608808 X:138373929-138373951 AAACAGAATGAAAAAGAGTGAGG + Intergenic
1199489206 X:148380151-148380173 AAACAGACTGAAAAGGAAGAAGG + Intergenic
1199783170 X:151081949-151081971 ACACAGAAGGAGAATGGAGAAGG + Intergenic
1200692078 Y:6316450-6316472 GAAGAGAATAAGAAAGAGGAAGG + Intergenic
1200713636 Y:6512489-6512511 GAAGAGAATAAGAAAGAGGAAGG - Intergenic
1201020291 Y:9649552-9649574 GAAGAGAATAAGAAAGAGGAAGG + Intergenic
1201043194 Y:9858277-9858299 GAAGAGAATAAGAAAGAGGAAGG - Intergenic
1201461748 Y:14233042-14233064 AAGAAGAATGAGGAGGAGGAGGG - Intergenic