ID: 1154958146

View in Genome Browser
Species Human (GRCh38)
Location 18:21279796-21279818
Sequence TAAATCAGGACAGCCACAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154958146_1154958150 7 Left 1154958146 18:21279796-21279818 CCACCTGTGGCTGTCCTGATTTA No data
Right 1154958150 18:21279826-21279848 TTTAAAAAACAGTACTTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154958146 Original CRISPR TAAATCAGGACAGCCACAGG TGG (reversed) Intronic