ID: 1154958300

View in Genome Browser
Species Human (GRCh38)
Location 18:21281741-21281763
Sequence TTGGCTGTAAACAGGCATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 1, 2: 7, 3: 26, 4: 254}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154958300 Original CRISPR TTGGCTGTAAACAGGCATGA GGG Intronic
902245897 1:15120206-15120228 ATGGCTGAAAACAGGCATCTTGG - Intergenic
904478074 1:30777354-30777376 CTGGCTGAAAACAGGCAAGGTGG - Intergenic
904617865 1:31759746-31759768 CTGGCTATACACAGGCAGGAGGG - Intronic
905633910 1:39536371-39536393 TTGGCAATAAAAAGGAATGATGG + Intergenic
906245065 1:44267670-44267692 TTGGCTGCAAGCAGGCAGGCGGG - Intronic
906580074 1:46928979-46929001 TTGGCTTTAAAGAGGAAGGAGGG + Intergenic
906603649 1:47149907-47149929 TTGGCTTTAAAGAGGAAGGAGGG - Intergenic
907091162 1:51727551-51727573 TTGACTGTAGAGAAGCATGAGGG + Intronic
910252850 1:85216175-85216197 TTGGAGGTAGTCAGGCATGATGG + Intergenic
911499811 1:98671667-98671689 TTAACTGTAAGCAGGCATAATGG - Intronic
912176412 1:107163270-107163292 TTGGATTTAAACAGGTCTGAAGG + Intronic
912385047 1:109267291-109267313 GTGGCTGGAGACAGGCAGGATGG + Intronic
913177754 1:116290601-116290623 TATGCTGGAAACAGGCATGCAGG - Intergenic
913329412 1:117654659-117654681 AAGGCTGAAAACAGGCAGGAAGG + Intergenic
914460620 1:147879887-147879909 TTGACTGTAAAGAGGCTAGAAGG - Intergenic
915759274 1:158294639-158294661 TTGACTACAAACAGGTATGAGGG - Intergenic
916073863 1:161188681-161188703 TTGGCAGGAAATAGGCAAGAAGG - Exonic
916272683 1:162960587-162960609 TTGACTCCAAAGAGGCATGAGGG - Intergenic
916889285 1:169100896-169100918 TTGGCTCAAAAAAGCCATGAAGG + Intergenic
918402071 1:184173527-184173549 TTGACTGTAATCTGGCATGGTGG - Intergenic
918615774 1:186541832-186541854 TTGGCTGTAAACAGCATTAATGG - Intergenic
919891013 1:201974618-201974640 TTGGCTATAAAAAGGCAGCATGG - Intergenic
920790836 1:209089440-209089462 TTGACTGCAAAAGGGCATGAGGG - Intergenic
922366528 1:224869781-224869803 TTGACTGTGAAGGGGCATGAGGG + Intergenic
923760234 1:236835595-236835617 TTGGATGTCAACATGGATGATGG + Exonic
924417453 1:243872055-243872077 TTGACTGCAAAAAGGCACGAGGG - Intergenic
1063638804 10:7811586-7811608 TGAGCTGTGACCAGGCATGATGG + Intergenic
1063702031 10:8394209-8394231 AGGGCTGTAAACAGCCAGGAAGG + Intergenic
1064240203 10:13620561-13620583 CAGGCTGGGAACAGGCATGAAGG - Intronic
1069019932 10:63474986-63475008 TTGACTGTGAAGTGGCATGAAGG + Intergenic
1069969630 10:72155413-72155435 TTCACTGGAAAAAGGCATGAGGG + Intronic
1069996825 10:72347417-72347439 TTAGCTGTAAAGAGGAATGGGGG + Intronic
1070174078 10:73955676-73955698 TTTGCTGGAAAGGGGCATGAAGG + Intergenic
1070229745 10:74552456-74552478 TTGACTGTAAATAGGCATGGAGG + Intronic
1070396205 10:76013163-76013185 TTGGCTATAAAAAGGAGTGAGGG + Intronic
1071506592 10:86235523-86235545 TTGACTGTAAACAGGCATGAGGG - Intronic
1072520389 10:96225473-96225495 GTGGCTGTACTCAGGCATGAGGG + Intronic
1072979000 10:100084028-100084050 TTAACTGTAAATGGGCATGAGGG + Intergenic
1072992119 10:100206528-100206550 TTGACTGAAAAGAGACATGAGGG + Intronic
1076574921 10:131458281-131458303 TTGACTGGAAATAGGTATGAGGG - Intergenic
1077698926 11:4421674-4421696 TTTGCAGTGAACAGGCAAGATGG - Intergenic
1078173895 11:8954245-8954267 TTAACTGTAAATGGGCATGAGGG + Intronic
1078514506 11:12010106-12010128 TTGGCGGTAAACAGTAATGTGGG - Intergenic
1078815699 11:14820460-14820482 TTAACTATAAATAGGCATGAAGG + Intronic
1079414068 11:20216504-20216526 TTGGCTGTGAAGAGGGAGGAAGG - Intergenic
1079671158 11:23173003-23173025 TTAACTGTAAACTGGCATGAAGG + Intergenic
1080487130 11:32720819-32720841 TTGCCTGGGAAGAGGCATGAGGG + Intronic
1081400666 11:42638454-42638476 TTGTCTGTAAAGAGGCATGAGGG - Intergenic
1081622469 11:44626800-44626822 TTGGCTGTCATCTGGGATGATGG - Intergenic
1082929884 11:58591570-58591592 TTAACTATAAACAGGCATGAAGG - Intronic
1083377139 11:62233216-62233238 TTGACAATAACCAGGCATGAGGG - Intergenic
1085131524 11:74043319-74043341 TCAGCTGTAAAAAGGAATGAAGG - Intronic
1086289973 11:85297469-85297491 TTGTCTGGAAACAGGCAGAATGG - Intronic
1086563580 11:88197698-88197720 TTGGAGGTAAAAAGACATGATGG + Intergenic
1086789213 11:91014600-91014622 TTGAATGTAAAGAGGCATGCGGG + Intergenic
1088383421 11:109221915-109221937 TTGACTGAGAACAGTCATGATGG + Intergenic
1090854857 11:130602393-130602415 TCTTCTGTAAACAGGCATGAGGG + Intergenic
1093392446 12:18638737-18638759 GTGGCTTTAGACAGGTATGATGG - Intronic
1094438498 12:30448447-30448469 GTGGCTGCTAATAGGCATGAGGG + Intergenic
1096747229 12:53737031-53737053 TAGGCTGTAAACAGACACTATGG - Intergenic
1097595375 12:61621797-61621819 TTGGCTGTAAACAGCATTAATGG - Intergenic
1097971733 12:65640148-65640170 TTGGCTTTAAACACCCATAAGGG - Intergenic
1098306123 12:69104474-69104496 TTAGCTGTAAAAAGACTTGATGG - Intergenic
1099011653 12:77298270-77298292 TGGACTGGAAGCAGGCATGAGGG + Intergenic
1100666594 12:96760414-96760436 TTGACTGCAAATAGGCATAAGGG - Intronic
1101303513 12:103504657-103504679 TGTGCTGCAGACAGGCATGAAGG - Intergenic
1102131376 12:110531805-110531827 TTGACTGTAAACAGGTTTGGGGG - Exonic
1102303386 12:111787393-111787415 CTGGCTGGAATCAGGCATGGAGG - Intronic
1103579219 12:121901980-121902002 TTGGCCATAAAAAGGAATGAAGG - Intronic
1103814147 12:123639553-123639575 TTGACTGCAAGCAGGCATGAGGG - Intronic
1104038282 12:125113593-125113615 ATAGTTGTAAACAGACATGAGGG + Intronic
1105556586 13:21452211-21452233 TTAACTGTAAATGGGCATGAGGG + Intronic
1105639225 13:22245163-22245185 TTGACTGTGAACTGGCAGGAAGG - Intergenic
1105936654 13:25106714-25106736 TTGACTGGAAAGAGGCAAGAAGG + Intergenic
1106403957 13:29457288-29457310 TTGGCTGGAAAGAGGCATGAGGG - Intronic
1107277259 13:38690517-38690539 CTGGCTATCAACAGGCAGGATGG - Exonic
1108781177 13:53836434-53836456 TTAGCTGTAAATTGGCATGAGGG - Intergenic
1110332504 13:74288773-74288795 TTGGCTGAAAACTGGCAGGGTGG + Intergenic
1110916463 13:81027209-81027231 TTGACTGCAAAGGGGCATGAGGG - Intergenic
1112308053 13:98293235-98293257 TTGGCTGAGACCAGGCATGCTGG + Intronic
1112558422 13:100490698-100490720 TTGGCTGCAAACAGGCAGAAAGG - Intronic
1113276166 13:108733011-108733033 TTGGGTGTAAAAATGAATGAAGG + Intronic
1113771219 13:112910707-112910729 TAGACTGAAAACAGGCACGAGGG + Intronic
1115194646 14:30783171-30783193 TTGACTGCAAATGGGCATGAGGG + Intergenic
1116591012 14:46772805-46772827 GGGGCTGAAAACTGGCATGATGG - Intergenic
1117854996 14:60020608-60020630 TTGACTGTAAATGGACATGAAGG - Intronic
1119111011 14:71973866-71973888 TTGGCAGGAGACAGGCATGCAGG + Intronic
1119454554 14:74743579-74743601 TTGGCTGGATACAGGCACAATGG + Intergenic
1121012941 14:90532756-90532778 GTGGCTGAACACAGGCAGGAAGG + Exonic
1121911255 14:97794470-97794492 TTTGCTGTTACCAGGAATGAAGG + Intergenic
1122958128 14:105081983-105082005 TTGACTGTGAAGAGGCATGAGGG - Intergenic
1126324391 15:47460916-47460938 TTTGCCCTAAACAGGCATGCTGG + Intronic
1130606723 15:85324325-85324347 TTGGCTGTAAGCAGGAAAAAGGG + Intergenic
1131297291 15:91161158-91161180 GTGACTGCAAACAGGCATGATGG + Intronic
1132071692 15:98783323-98783345 TAGTTTGTAACCAGGCATGAAGG - Intronic
1133073917 16:3264837-3264859 TTTGCTGTAAACATGAAAGAAGG - Intronic
1133362112 16:5182447-5182469 TTGGCCATAAAAAGGAATGAAGG + Intergenic
1133655910 16:7863519-7863541 TTGACTGCAAATAGGCATCAGGG + Intergenic
1134466517 16:14483651-14483673 CTGTCTAAAAACAGGCATGAGGG - Intronic
1134901888 16:17945635-17945657 TTCACTGTAAATGGGCATGAAGG + Intergenic
1135177599 16:20244570-20244592 TTAGAAGTAAACATGCATGAGGG - Intergenic
1138484229 16:57326299-57326321 GTGACTGTTAACAGTCATGAGGG - Intergenic
1138649027 16:58447080-58447102 TTGCCTGTGAATGGGCATGAAGG + Intergenic
1144637333 17:16918559-16918581 GTGGCTTGAAGCAGGCATGAAGG + Intergenic
1146925317 17:36740350-36740372 TTGGCAGAAGACAGGCATGAGGG - Intergenic
1147174456 17:38644957-38644979 TTTCCTGGAAAGAGGCATGAGGG + Intergenic
1150354192 17:64469345-64469367 CTGGCCCTAAACATGCATGATGG - Intergenic
1150966052 17:69969943-69969965 TTGGCTGGAAATAGTCTTGATGG - Intergenic
1151046601 17:70927428-70927450 TTGACTGTAATCAGGCCTAAAGG - Intergenic
1151779242 17:76231875-76231897 TTAACTGTAAATGGGCATGATGG - Intronic
1153031372 18:716340-716362 TTGACTGTAAAAGGGCATAATGG + Intergenic
1153068417 18:1076032-1076054 TTGGCTGTAAACAGACTTAGTGG - Intergenic
1153070883 18:1103056-1103078 TTGGCTGTGAAGAGGGATGTGGG + Intergenic
1154958300 18:21281741-21281763 TTGGCTGTAAACAGGCATGAGGG + Intronic
1155307358 18:24491888-24491910 ATGGCTGTAAACAGGGGAGAGGG + Intergenic
1155626447 18:27840589-27840611 TATGCTGTAAACAGGCTTTATGG - Intergenic
1155644588 18:28062025-28062047 GTGGCTGTCAAAAGGAATGAGGG - Intronic
1157832533 18:50869983-50870005 TTGGCTGGAAAGAGACATAAAGG - Intergenic
1157933614 18:51850192-51850214 TTGACTGCAAAGAGGCATGAGGG - Intergenic
1158038524 18:53064959-53064981 TTGGCTGTAATGAGTCATGCTGG - Intronic
1158272927 18:55736153-55736175 TTGACAATAAACAGGCATGATGG - Intergenic
1158480538 18:57817827-57817849 TTGGCTATAACCAGGAATGAAGG - Intergenic
1158522543 18:58183828-58183850 TAGGCTGTAAATAGGAAAGAGGG - Intronic
1158656849 18:59344929-59344951 TTGACTTTAAGGAGGCATGAGGG + Intronic
1163400646 19:17090449-17090471 TTGGCCATAAAAAGGAATGAAGG - Intronic
1163476677 19:17530579-17530601 ATGGATGGAAACAGGCATGGAGG + Intronic
1167141882 19:47657274-47657296 TTGGCAGTAAAAGGGAATGAAGG - Intronic
926852623 2:17216542-17216564 TTGACTGCAAACAAGCATAAGGG + Intergenic
927299300 2:21492725-21492747 TTGACTGTGAAGAGGCATAAGGG - Intergenic
928156704 2:28883408-28883430 TGAAGTGTAAACAGGCATGAGGG - Intergenic
933056177 2:77668748-77668770 CTGACTGTAAATAGGCATTAAGG + Intergenic
933082754 2:78013799-78013821 TTGGCTCTAAACAGGCTAGTAGG + Intergenic
933523763 2:83409908-83409930 TTGGCTGAATAAATGCATGAAGG + Intergenic
933927732 2:87113060-87113082 CTGACTGTAAATAGGCATTAAGG + Intergenic
935322721 2:101904756-101904778 TTGGATGCAAAGAGGCAGGAGGG - Intergenic
937226073 2:120369664-120369686 TTAGCTGTAAAAAGAAATGAAGG - Intergenic
937244893 2:120486289-120486311 TTGGCTGGAAGGATGCATGAGGG - Intergenic
937536907 2:122900388-122900410 CTGGCTGGGAACTGGCATGATGG - Intergenic
938396866 2:130957474-130957496 TTAACTATAAATAGGCATGAAGG + Intronic
941044897 2:160663522-160663544 TTTGCTGTAAAGGGGCATGAAGG + Intergenic
945601800 2:211876690-211876712 TTGACTGGTAAGAGGCATGAGGG + Intronic
945859577 2:215105312-215105334 TTGGCTTTTAACTGGCATGCAGG + Intronic
946152186 2:217783747-217783769 TTGGCTACAAACAGGAATAAGGG + Intergenic
946984138 2:225252611-225252633 TTGTCAGGAAAGAGGCATGAGGG - Intergenic
948244586 2:236468926-236468948 TTGTCTGTAAACATCTATGAAGG - Intronic
1169992246 20:11516392-11516414 TAGGCTGAAATCAGACATGATGG - Intergenic
1170317591 20:15059618-15059640 TTGGCTCAGAACAGGCCTGATGG - Intronic
1171133874 20:22679052-22679074 TTGGCTCAAAACAAGCATGGTGG - Intergenic
1172810134 20:37641426-37641448 GTGGCAGATAACAGGCATGAGGG - Intergenic
1172877469 20:38174401-38174423 TTGCCTGCAAAAGGGCATGAGGG - Intergenic
1173036561 20:39417236-39417258 TTGGATGTGAACAGCCTTGAAGG + Intergenic
1173083604 20:39893124-39893146 ATGTCTGTAAACATACATGAGGG + Intergenic
1173441757 20:43083759-43083781 ATGACTGTGAACAGGCATGAAGG - Intronic
1174582787 20:51584278-51584300 TTGGCTATGAACAAGAATGAGGG - Intergenic
1175475603 20:59271723-59271745 TTGTCTGCAAACGTGCATGATGG - Intergenic
1181824011 22:25498889-25498911 TTGACTGGAAAGGGGCATGATGG - Intergenic
1181838837 22:25636687-25636709 TTGACTGGGAAGAGGCATGAAGG - Intronic
1184221337 22:43102036-43102058 TTGGCTGGGAAGGGGCATGATGG - Intergenic
1184256915 22:43292339-43292361 TTGGCTGAAAACAGTCTTTATGG + Intronic
1184570165 22:45317962-45317984 GTGGCTGCCAGCAGGCATGAGGG + Intronic
1185045839 22:48528370-48528392 TTGGCTATACACAGGCATCGGGG - Intronic
949188405 3:1221002-1221024 TTGCCTGGAAAGCGGCATGAGGG - Intronic
949929253 3:9065474-9065496 TTGGCTGCAAAGGGCCATGAGGG - Intronic
951063908 3:18242125-18242147 TTAATTGGAAACAGGCATGAGGG + Intronic
951425293 3:22537718-22537740 TTGACTGAAAAGAGGCATCAGGG + Intergenic
951597661 3:24335634-24335656 TTGGCTGGCAAGGGGCATGAGGG - Intronic
951601798 3:24384844-24384866 TTGACTGTGAAGAGGCATAAAGG + Intronic
952228983 3:31409498-31409520 TTAACTGTAAACAGGCATGAGGG - Intergenic
952865477 3:37852552-37852574 TGTGCAGTAAACAGGCAGGATGG + Intergenic
953376619 3:42433783-42433805 TTGCCTGGAAAGGGGCATGAAGG + Intergenic
953850313 3:46461641-46461663 TTAACTATAAACAGGCATGAGGG + Intronic
954441129 3:50522560-50522582 TTCTCTGGAAACAGGCATAATGG - Intergenic
954955372 3:54513971-54513993 GTGCATATAAACAGGCATGACGG - Intronic
955090048 3:55741578-55741600 TTGTCTGTAAAAAGGCAAAAGGG - Intronic
959087904 3:101870595-101870617 TTGACTGCAAAGGGGCATGAAGG - Intergenic
960835409 3:121901438-121901460 ATAGATGTAGACAGGCATGAAGG + Intronic
961388484 3:126537844-126537866 TTGTCTGTAAACAGGGACAACGG - Intronic
962529440 3:136265339-136265361 CTGACTGCAAACAGGCAAGAAGG - Intronic
962822015 3:139058210-139058232 TTATATGCAAACAGGCATGAAGG - Intronic
963100441 3:141597471-141597493 TGGGGTATAAACAGGCATGAGGG + Intronic
964283516 3:155092858-155092880 TTGGCTGCAAATGGGCATAAGGG + Intronic
964700421 3:159559720-159559742 TTGACTGCAAAAGGGCATGAGGG - Intronic
965767192 3:172143329-172143351 TTACCTGTAAAAATGCATGAGGG + Intronic
965847017 3:172974923-172974945 TTGGATGTAACCTGGCATAAAGG - Intronic
966325950 3:178754705-178754727 TTTGCTGTAACAAAGCATGAAGG + Intronic
966504502 3:180684523-180684545 CTGACTGGAAAGAGGCATGAGGG - Intronic
966707962 3:182937536-182937558 TTGGCAGTAAAAAGGAATGAGGG - Intergenic
967177955 3:186877590-186877612 TTGGCTGTAAAAGAACATGAAGG + Intergenic
968355858 3:198106180-198106202 GTGGCTGTAAGCAGGTAAGATGG - Intergenic
969242825 4:5912204-5912226 TTGGCTCTCAAAAGGCATGCAGG + Intronic
971918142 4:32901951-32901973 TTGGCTGTAAACCAGGCTGATGG - Intergenic
972428804 4:38960654-38960676 TTGGTTGTAATTAGTCATGATGG + Intergenic
972628726 4:40825041-40825063 TTGGCAATAAAAAGGAATGAAGG - Intronic
973829572 4:54745087-54745109 TTAACTGCAAACAGGCATAAGGG - Intergenic
974661088 4:64889418-64889440 TTAGCAGTAAACAGGCAAAAAGG - Intergenic
974972804 4:68850298-68850320 TGGACTGCAAAGAGGCATGAAGG + Intergenic
979350140 4:119634506-119634528 TTGACTGCGAAGAGGCATGAGGG + Intergenic
979710410 4:123772660-123772682 CTGGCTGTACACACGCATGGGGG + Intergenic
979753458 4:124308872-124308894 TTGACTGAAAAGAGGCTTGAGGG + Intergenic
981817403 4:148846788-148846810 GTTTCTTTAAACAGGCATGATGG - Intergenic
985940984 5:3135653-3135675 TTGGCTGTGTAGAGGCATGATGG - Intergenic
989119526 5:37990404-37990426 ATGGCAGTAAACAGGCCTGGAGG - Intergenic
991252767 5:64582197-64582219 GTGGCAGAAAACAGGCATTAAGG - Intronic
991564010 5:67985777-67985799 TTGGCTGGAATGAGGCAGGATGG - Intergenic
992212501 5:74494586-74494608 TCTGCAGTAGACAGGCATGAAGG - Intergenic
992782921 5:80144183-80144205 TTAGCAGTAAAAAGGAATGAAGG - Intronic
996496734 5:124166023-124166045 TTGATTGTAAAGAGCCATGAAGG - Intergenic
998923402 5:147095972-147095994 GTGGCTGCAAAGAGGCAGGAGGG + Intergenic
1000010620 5:157228282-157228304 TTTCCTTTTAACAGGCATGAAGG + Exonic
1002260012 5:177986490-177986512 TTTGATGGAAACCGGCATGAGGG + Intergenic
1003691464 6:8358393-8358415 TTAACTGTAAACAGGCATGAGGG - Intergenic
1004193003 6:13480655-13480677 TTGTCTCTAGCCAGGCATGATGG - Intronic
1005420031 6:25639577-25639599 TTGACTAAAAACAGGCAGGATGG - Intergenic
1005559790 6:27026863-27026885 TTGACTGTAAATGGGCATGAAGG - Intergenic
1009303006 6:62051120-62051142 CTGGCTGGAAAGCGGCATGAAGG + Intronic
1009981822 6:70735270-70735292 TTGACTGGAAATTGGCATGAAGG - Intronic
1011203838 6:84869784-84869806 TTGACTAGAAACAGGCCTGAGGG - Intergenic
1013338349 6:109188361-109188383 TTGGCTGTGGCCAGGCATGGTGG + Intergenic
1014218563 6:118777117-118777139 TTAACTGTAAATGGGCATGAAGG + Intergenic
1015453060 6:133392707-133392729 TTGGCTTGAAATAGGCATGGTGG + Intronic
1015883584 6:137893367-137893389 TGGGCTGGAAAAAGGGATGAAGG - Intergenic
1017585234 6:155913504-155913526 GTAACTGTAAACAGGCACGAGGG + Intergenic
1017683911 6:156892668-156892690 CTGGCTGGAAAGAGACATGAAGG - Intronic
1017811309 6:157985797-157985819 TTTGCTGTGAACAGGCAGCAGGG + Intronic
1018052549 6:160023824-160023846 TTGGGTGTAGACAGGAAAGAGGG + Intronic
1018326990 6:162681576-162681598 TTGGCTGTAGACAGTAATCAGGG - Intronic
1018415636 6:163600158-163600180 TTGGCTGTACCCAGGGAAGAAGG - Intergenic
1018997837 6:168723997-168724019 CTGGCTGAGACCAGGCATGAGGG + Intergenic
1019009359 6:168829689-168829711 TTGGCTGCCAAGGGGCATGAAGG + Intergenic
1021314039 7:19124167-19124189 TAGGTTGCAAACAGGCAGGAAGG + Intergenic
1021863286 7:24928660-24928682 TTGACTGCAAAAGGGCATGAGGG - Intronic
1024489911 7:49969047-49969069 TGGGCTGTAAAGAGACCTGATGG + Intronic
1024886612 7:54149179-54149201 TTGGCTGGAAACATTCAAGATGG - Intergenic
1025125563 7:56341703-56341725 TTGACTGTAAAGGGGAATGAAGG - Intergenic
1026103800 7:67404852-67404874 TAGACTGTAAAGATGCATGAAGG - Intergenic
1028046520 7:86127147-86127169 TTGACTGGAAAGAGGCATTAAGG - Intergenic
1028481505 7:91311318-91311340 CTGGCTTTAAAGATGCATGATGG + Intergenic
1029840497 7:103357973-103357995 TTGTCATTAAACAGGCATAAAGG - Intronic
1030329619 7:108257206-108257228 CTGACTATAAACAGGCAGGAGGG + Intronic
1030897992 7:115085508-115085530 CTGGATATATACAGGCATGAAGG + Intergenic
1031346539 7:120673860-120673882 AAGGCTGGAAAAAGGCATGAAGG - Intronic
1031962640 7:128003826-128003848 TTGGCTGTGAAAGGGCATGATGG - Intronic
1032421036 7:131779309-131779331 TTGGCTGCAAAGAGGCATGAGGG - Intergenic
1033269882 7:139921217-139921239 TTGACTGAGAAGAGGCATGAGGG - Intronic
1034666436 7:152821867-152821889 GTGGTTGTGAACAGGCCTGAGGG + Intronic
1037269794 8:17114352-17114374 TTGTCAGAAAACAGCCATGAGGG + Intronic
1039421575 8:37447761-37447783 CTGACTGCAAAGAGGCATGAAGG + Intergenic
1040741894 8:50585925-50585947 ATGGTTGTAAACAGAAATGAAGG + Intronic
1040876520 8:52158142-52158164 TTTGCTGTCAAAGGGCATGAAGG + Intronic
1041202108 8:55460285-55460307 TTGACTGCAAACAGGCATGAGGG + Intronic
1042373712 8:68022765-68022787 TAGGCTGTAAAGGGACATGAAGG - Intronic
1043292723 8:78623314-78623336 TGAGATGTAAAAAGGCATGATGG - Intergenic
1044463649 8:92478740-92478762 TTAACTGTAAACAGGCATGAGGG - Intergenic
1044517223 8:93153650-93153672 TTCCCTGTAGACAGGCAGGACGG - Intronic
1044687698 8:94843653-94843675 TTGGCTGTATACACATATGATGG + Intronic
1046143887 8:110131685-110131707 TTAACTGTAAATGGGCATGAGGG + Intergenic
1046801054 8:118427430-118427452 TTGACTGTAAAGGGGAATGAAGG - Intronic
1048164952 8:132054155-132054177 TTGGCTAGGAGCAGGCATGAAGG - Intronic
1049397391 8:142407578-142407600 CTGGCTGAAAGCAGACATGATGG - Intergenic
1050074094 9:1845916-1845938 ATGGCTGTTCACAGGCAGGAAGG + Intergenic
1050304147 9:4290096-4290118 TTAGCTGTAAATAGGCATTATGG - Intronic
1050753573 9:8971352-8971374 TTGACTTTGAACAGGCAGGAAGG - Intronic
1050755384 9:8996480-8996502 TTGACTGCAAAGAGGAATGAAGG + Intronic
1052915132 9:33919310-33919332 CTGGCTGTAAACTTGCATGGGGG - Exonic
1055562486 9:77534846-77534868 TTGGCTGTAGACAGTCAGGATGG + Intronic
1056471956 9:86914068-86914090 TTGGCAATAAAAAGGAATGAAGG + Intergenic
1059090308 9:111349693-111349715 TTGACTGTAAATGGGCATGAGGG - Intergenic
1059297945 9:113289026-113289048 TTGGCTGGAAAAGGGCATGAGGG - Intronic
1059531337 9:115038347-115038369 TTGGCTGTCACCAGGCCAGATGG + Exonic
1061775121 9:132957815-132957837 ATGGCTGTAACCAAGCATGCTGG + Intronic
1187034199 X:15520391-15520413 TTGACTGCAAATAGGTATGAAGG + Intronic
1187421302 X:19136259-19136281 TTGGCCATAAAAAGGAATGAAGG + Intergenic
1187441027 X:19319950-19319972 TTGACTGGCAAGAGGCATGAGGG + Intergenic
1187530249 X:20090002-20090024 TTGACTGTAAAGAGGCAAAAGGG - Intronic
1189082351 X:37988208-37988230 CTGGCTGTAAATAGGAAGGAAGG + Intronic
1189092355 X:38099011-38099033 CTGACTGCAAACAGGCATGGGGG + Intronic
1189488825 X:41453754-41453776 TTGGCCTTAAAAAGGAATGAAGG - Intronic
1192790062 X:74372755-74372777 CTGCCTGGAAACAGGGATGAAGG - Intergenic
1193820244 X:86152684-86152706 TTGGAAGTTAACAGTCATGAAGG - Intronic
1195743793 X:108093191-108093213 TTAACTATAAATAGGCATGAGGG - Intronic
1198116975 X:133553907-133553929 TTAACTGTAAACTAGCATGAGGG - Intronic
1198692369 X:139298254-139298276 TTGGCTTAAAACATCCATGAAGG + Intergenic
1198939733 X:141940263-141940285 TTGGCTGTAAACTTGCTAGAGGG + Intergenic
1199366479 X:146991006-146991028 TTGTCTGCAAATAGGCATAAGGG + Intergenic
1200311110 X:155078451-155078473 TTGGCTTTAAATGGGCATTATGG + Intronic
1200315303 X:155126390-155126412 TTGGCCATAAAAAGGAATGAGGG + Intronic
1200841573 Y:7786528-7786550 TTAGCAGTAACCAGGCAAGAAGG - Intergenic
1201537592 Y:15067860-15067882 TTGTCTTGAAAAAGGCATGAGGG + Intergenic
1201668303 Y:16485402-16485424 TTGGCTGGAAAAGGGAATGAGGG - Intergenic