ID: 1154961204

View in Genome Browser
Species Human (GRCh38)
Location 18:21310629-21310651
Sequence CTGAGATCCTTTCAGGGTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154961204_1154961207 -10 Left 1154961204 18:21310629-21310651 CCGACACCCTGAAAGGATCTCAG 0: 1
1: 0
2: 0
3: 20
4: 202
Right 1154961207 18:21310642-21310664 AGGATCTCAGATACCCCCACAGG 0: 1
1: 0
2: 3
3: 12
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154961204 Original CRISPR CTGAGATCCTTTCAGGGTGT CGG (reversed) Intronic
900861773 1:5238773-5238795 CAAAGACCCTTTCAGGATGTTGG + Intergenic
901744101 1:11361191-11361213 CTGAGAACCTTTCTGGGTCAAGG + Intergenic
902053017 1:13579022-13579044 CTGAGGTTCTTTCATGGTGAGGG + Intergenic
902247542 1:15130947-15130969 CTCAGCTCCTTGCAGGCTGTTGG - Intergenic
904836666 1:33342133-33342155 CTGAGTTCCTTGCAGGGGGCTGG + Intronic
904902847 1:33870940-33870962 CTGAGTTCCTCACTGGGTGTTGG - Intronic
906432831 1:45769467-45769489 TTGAGTTCCTTGCAGGCTGTGGG + Intergenic
906523473 1:46480320-46480342 CTGTGGTCATTTCAGGGTGGAGG + Intergenic
908316054 1:62933723-62933745 CTGCCTTCCTATCAGGGTGTTGG - Intergenic
908851703 1:68383297-68383319 TTGAGGTCCTTTCAGGTTGCAGG + Intergenic
912683334 1:111742843-111742865 CTGAAGTCCTTTCATGGTGCTGG + Intronic
913157335 1:116112725-116112747 CTGAGATCCTTTCTGGACGAAGG - Intronic
914334289 1:146700825-146700847 CTGAGGCCATTTCAGGATGTGGG + Intergenic
916103529 1:161413064-161413086 CACAGACCCTTTAAGGGTGTGGG - Intergenic
918253228 1:182723372-182723394 CTGGGATCCTCTCTGGCTGTTGG + Intergenic
919060555 1:192626913-192626935 CTGAGTTCATTTCAGGGGATAGG + Intergenic
919759830 1:201090644-201090666 CCGAGATTCTTTCAGAGTGTCGG + Intronic
921252214 1:213308803-213308825 CTCAGATAATTTCAGGGTGTGGG + Intergenic
921357743 1:214302502-214302524 CGGAGACCCTTTCAGGGAGTTGG - Intronic
922481940 1:225945236-225945258 CTGAGATCCCTTCCTGATGTTGG + Intergenic
923468635 1:234270259-234270281 CTGAGATGGTTTCTTGGTGTGGG - Intronic
923493273 1:234503253-234503275 CTGATATAATGTCAGGGTGTGGG + Intergenic
1066493979 10:35922955-35922977 CTGACTTTCTTTCAGAGTGTTGG - Intergenic
1071008702 10:80912787-80912809 CTGAGCTCCTTTGATGGTTTTGG + Intergenic
1071765492 10:88659926-88659948 AAAAGATCCTTTTAGGGTGTTGG + Intergenic
1071880893 10:89897383-89897405 CTGAGATCTTTTCAGTGGGAAGG + Intergenic
1074466805 10:113691040-113691062 CTGAGGTCTTTTCAGGGGGAAGG + Intronic
1075983302 10:126760110-126760132 CTGAGATTCTTTCAGAGAGTCGG + Intergenic
1078745669 11:14112015-14112037 CTGACAGCCTTTCAGGTTCTCGG - Intronic
1079069726 11:17333610-17333632 TTGAGATCCTTTGAGACTGTAGG + Intronic
1079627466 11:22633679-22633701 CTAAGGTCTTTTCAGGGTGAAGG + Intronic
1080978073 11:37365716-37365738 CTAAGATCTTTTCAGGGGGAAGG - Intergenic
1085123956 11:73984824-73984846 CTTAAATTCTTTCAGGGTGGGGG + Intergenic
1088254831 11:107893575-107893597 CTGAGATCCATTAAGTGTTTTGG - Intronic
1090395205 11:126414226-126414248 CCGAGATCCAGTCAGGGTGGGGG + Exonic
1091988365 12:4932876-4932898 CTGATATCCTTTCAGGACATGGG - Intergenic
1092289484 12:7150722-7150744 CTCAGCTCCTTTCTGGGGGTGGG - Intronic
1092717953 12:11410886-11410908 CTCAGTTCCTTTCAGGATTTGGG - Intronic
1095445690 12:42279857-42279879 CTGAATTCCTTGCAGGTTGTTGG + Intronic
1095932370 12:47640323-47640345 CTTACATCCTTTCCTGGTGTTGG - Intergenic
1097350519 12:58543698-58543720 CTCAGACCCTTTACGGGTGTCGG + Intergenic
1097823340 12:64149645-64149667 CTAAGATTCTTACAGGGTGCAGG - Exonic
1099308135 12:80983569-80983591 CTCAGGTCCTTTCAGGTTTTGGG + Intronic
1099795165 12:87391377-87391399 CTTAGATTCTTTCAGGGGTTTGG + Intergenic
1101496452 12:105259096-105259118 CTGAGGTCATTTTAGGCTGTGGG + Intronic
1103919419 12:124391602-124391624 CTGAAATCCTATCAGGATGTTGG + Intronic
1104090009 12:125508488-125508510 CAGAGTGGCTTTCAGGGTGTTGG + Intronic
1106424270 13:29610888-29610910 CTGGGATCATTGCAGGCTGTTGG + Intergenic
1106482688 13:30148616-30148638 CTGAGATGCTGTCAGGGTGGAGG + Intergenic
1107389851 13:39952790-39952812 CTGAGAACCATTGGGGGTGTTGG + Intergenic
1107432782 13:40354933-40354955 CTGAGAACACTTCAGGGTGGTGG + Intergenic
1108483032 13:50894572-50894594 CTGACATACTTACAGGGTCTTGG - Intergenic
1110209232 13:72953071-72953093 CTGAGGTCTTTTCAGGGAGAAGG + Intronic
1112044013 13:95577013-95577035 CTCATCTCCTTTCAGGATGTTGG + Intronic
1113636295 13:111921168-111921190 CTGAGAACCTTTCTGTGTTTGGG - Intergenic
1114931288 14:27470922-27470944 CTGAGATGAGTTCAGGATGTTGG - Intergenic
1115645287 14:35365166-35365188 CTGGAATCCTTTGAGGGGGTAGG - Intergenic
1115646362 14:35370960-35370982 CTGAGTCCATTTCTGGGTGTGGG - Intergenic
1116370226 14:44121379-44121401 GTGTTATCCTTTGAGGGTGTTGG + Intergenic
1118983798 14:70736160-70736182 TTAAGATTCTTTCATGGTGTGGG - Intronic
1123175203 14:106410341-106410363 CTGATTTCCTGTCAGGATGTGGG - Intergenic
1123186098 14:106518427-106518449 CTGATTTCCTGTCAGGGTGTGGG - Intergenic
1123193348 14:106592525-106592547 CTGATTTCCTGTCAGGATGTGGG - Intergenic
1124556682 15:30732317-30732339 AGGTGATCTTTTCAGGGTGTGGG + Intronic
1124674596 15:31673420-31673442 AGGTGATCTTTTCAGGGTGTGGG - Intronic
1127000243 15:54495318-54495340 ATAAGTTCCTTTCAGGGTGGGGG - Intronic
1128271350 15:66312630-66312652 CTCAGATGCTGTCAGGGTCTTGG + Intronic
1130603476 15:85294206-85294228 CTGAGTACATTTCAGGCTGTGGG - Intergenic
1131249159 15:90819469-90819491 CTCAGATCTATTCAGGATGTGGG + Intergenic
1131285326 15:91052181-91052203 CTGAGTACATTTCAGGCTGTGGG + Intergenic
1133098907 16:3467251-3467273 CTGAGATCCCTGCAGGGTCTGGG + Intronic
1134379225 16:13708845-13708867 CTGAGCTCCCTTGGGGGTGTTGG - Intergenic
1136870529 16:33803347-33803369 CTGATTTCCTGTCAGGATGTGGG + Intergenic
1137594274 16:49713548-49713570 CTGAGAACCTGCCAGGGTGCGGG - Intronic
1137597894 16:49737013-49737035 CTCAGCTCCCCTCAGGGTGTAGG - Intronic
1137875356 16:51991606-51991628 CTCAGATCCTTTCTAGCTGTAGG + Intergenic
1137883854 16:52080997-52081019 CTGAGATCGTGTCAGAGTGAAGG - Intergenic
1138580780 16:57939367-57939389 CTGAGGTCCTTTTAGGCTGGAGG - Intronic
1139260954 16:65593253-65593275 ATGAGTTCCTTTCAGGGATTAGG + Intergenic
1140701689 16:77587277-77587299 AAGAGCTCCTTGCAGGGTGTGGG - Intergenic
1203101643 16_KI270728v1_random:1312703-1312725 CTGATTTCCTGTCAGGATGTGGG - Intergenic
1143298424 17:5889125-5889147 CTTAGATCCTTGCTGGCTGTTGG + Intronic
1148582225 17:48752166-48752188 CTGAGGTCTTATCAGTGTGTTGG + Intergenic
1148782795 17:50130870-50130892 CTGAGAGCCCTTCAGGATGCAGG + Intergenic
1148986952 17:51631061-51631083 CTAGGATCCTTTGAGGGTGCTGG - Exonic
1149437052 17:56642100-56642122 TTCAGTTCCTTTCAGGCTGTTGG - Intergenic
1149614911 17:57988867-57988889 CTCAGATCCTCTCAGTGTGGAGG + Intergenic
1149772712 17:59333278-59333300 CTGAGATCCTATCATGGAGCTGG - Intronic
1150409352 17:64930430-64930452 CACAGACCCTTTAAGGGTGTCGG - Intergenic
1152370100 17:79881711-79881733 CTGAGATTCATTCATGCTGTTGG + Intergenic
1153143455 18:2001351-2001373 CACAGACCCTTTAAGGGTGTCGG + Intergenic
1154161306 18:11982211-11982233 CTGAGCCACTTTCAGGGTGTGGG - Intronic
1154961204 18:21310629-21310651 CTGAGATCCTTTCAGGGTGTCGG - Intronic
1155027058 18:21950604-21950626 TTGAGATCCATTCAAGATGTTGG + Intergenic
1157297730 18:46458149-46458171 CTGAGAACCTTGTGGGGTGTCGG + Exonic
1161147324 19:2686674-2686696 TTGGGATCGTTTCAGGGTGTTGG - Intronic
1161346756 19:3772092-3772114 CAGAGATCCCCTCAGGGTGGAGG - Intronic
1161555281 19:4938288-4938310 CTGACATACTTTCTGGGTTTTGG + Intronic
1162258540 19:9513272-9513294 CTTAAAGCCTTTCAGGGTGTAGG - Intergenic
1162874216 19:13608860-13608882 CTGAGATCCTATCAGGGAGGTGG - Intronic
1168675547 19:58275405-58275427 CTGAGATCCTTTCAAGGGATCGG - Intronic
926620567 2:15043318-15043340 CTGAGATCCTTGGAAGGTGGAGG - Intergenic
926751529 2:16202286-16202308 CTGTGGGCCTTGCAGGGTGTTGG + Intergenic
929030042 2:37641482-37641504 CTGAGATCATTTTAGGGAGAGGG - Intergenic
930172731 2:48267907-48267929 CTGAGTTCCTTGCTGGATGTAGG - Intergenic
930430264 2:51266276-51266298 ATGGGATCCATTCAGTGTGTTGG + Intergenic
932447172 2:71788041-71788063 CTGAGATGCTCTCAGTGTCTTGG - Intergenic
932600324 2:73119747-73119769 CAGAGACCCTTTACGGGTGTCGG + Intronic
935120048 2:100176382-100176404 CTGAGACCCTGTAAGTGTGTGGG - Intergenic
936378509 2:111963379-111963401 CACAGATCCTTTACGGGTGTCGG + Intronic
936669149 2:114635958-114635980 CTGAGAAGCTTTCAATGTGTTGG + Intronic
936976983 2:118230320-118230342 CTGAGACCCCTTCAGGGGGTTGG + Intergenic
937291775 2:120786138-120786160 CTGAGACCCGTCCAGGGTGGTGG - Intronic
937973017 2:127564890-127564912 CTGGGAGCCTTGCAGGTTGTTGG - Intronic
938959355 2:136327266-136327288 CTGACCTCCTTGCAGGGTTTCGG + Intergenic
940849565 2:158675107-158675129 CTCAGAACCTTTTAGGGTCTTGG + Intronic
942300049 2:174552408-174552430 CTGCGTTTCTTTCAGTGTGTTGG - Intergenic
944379993 2:199097385-199097407 CTGTGATCCTTTCAGGAGCTTGG - Intergenic
945585508 2:211656770-211656792 TTGAGATCCATCCATGGTGTTGG + Intronic
946714908 2:222543393-222543415 CAGACATCCTTTGAGGGTCTTGG - Intronic
948127082 2:235572183-235572205 CTGAGAGCCCTTGAGGGTGGGGG + Intronic
948468926 2:238165159-238165181 CTGGGCTCCCTTCTGGGTGTGGG - Intronic
948584325 2:239009548-239009570 CTGAGAACCTTTAAGCGGGTGGG - Intergenic
1172062507 20:32196237-32196259 ATGAGATCTTTTCACGGGGTTGG + Exonic
1173222377 20:41140499-41140521 CTGTGCTACCTTCAGGGTGTTGG + Intronic
1174017723 20:47502164-47502186 CTGAGGTAGTTTCGGGGTGTCGG + Intronic
1174354239 20:49987772-49987794 ATGGGATTCTTTCAGGGTTTGGG + Intronic
1174385675 20:50187435-50187457 TTGAGATCCTTTCCGGCTCTAGG + Intergenic
1174548629 20:51345012-51345034 GTGAGAGCCTTTCTCGGTGTTGG - Intergenic
1174917780 20:54671340-54671362 CTGAGATCCTTTCAAAGATTTGG + Intergenic
1175988131 20:62774481-62774503 CTGACATCCTTTCAGGAGGGAGG + Intergenic
1178099350 21:29250788-29250810 TTCAGTTCCTTTCAGGCTGTTGG - Intronic
1178271399 21:31193280-31193302 CTGTGAGCCACTCAGGGTGTTGG - Intronic
1181273594 22:21674909-21674931 GTGAGGTCCTTGCAGGGTCTTGG + Intronic
1181961474 22:26625015-26625037 CCGTGATCCTGCCAGGGTGTGGG - Intronic
1182346432 22:29669273-29669295 TTGGGATGCTTTCAGGGTGATGG + Intronic
1183214956 22:36473612-36473634 CTGACATCATTGCAGGGTTTAGG - Intronic
1185226055 22:49653478-49653500 CTGAGATCCATGCTGTGTGTGGG + Intronic
950629551 3:14273252-14273274 CACAGACCCTTTAAGGGTGTTGG - Intergenic
950742974 3:15064701-15064723 CGCAGATCCTTTCGGGGTGACGG - Intronic
951936858 3:28031911-28031933 CTTAGATACTTTCACAGTGTAGG + Intergenic
952306228 3:32148927-32148949 CTGAGGTTATTTCAGGATGTAGG - Intronic
954441485 3:50524699-50524721 CTGAGTTTCTTGGAGGGTGTGGG - Intergenic
954501770 3:51024503-51024525 CTGAGATTTTATCAGGGTGAAGG + Intronic
954766269 3:52919793-52919815 CTGAGCTCCTTGCTGGGTGTTGG - Intronic
954946883 3:54433898-54433920 CGAAGATCATTTCAGGGGGTTGG - Intronic
954956046 3:54518990-54519012 CTAAGAACCTCACAGGGTGTGGG + Intronic
958466111 3:94461035-94461057 CTGAGATCCTGCCAGAGGGTTGG - Intergenic
960703554 3:120460169-120460191 CTGAGATTCTCTCAGGGTCTGGG + Intergenic
961512586 3:127412199-127412221 CACAGACCCTTTAAGGGTGTCGG + Intergenic
962088859 3:132221702-132221724 CTCAGATCATTTCAGGGAGCTGG + Intronic
962599542 3:136980898-136980920 CTCAGATCCTTTAAGGGTGGAGG + Intronic
964323929 3:155526595-155526617 TTCAGTTCCTTTCAGGCTGTTGG - Intronic
968858212 4:3144900-3144922 GGGAGATCATTCCAGGGTGTGGG + Intronic
972755139 4:42038733-42038755 CTCAGATCCTTTCTGGAAGTAGG + Intronic
974364512 4:60928644-60928666 CAGAGATCCTCTGGGGGTGTTGG + Intergenic
978837679 4:113172347-113172369 CTGTGATACTTTGAAGGTGTGGG + Intronic
980825268 4:138064458-138064480 CTAAGATACATTCATGGTGTTGG - Intergenic
981139629 4:141253571-141253593 CTGAGGTCTTATCAGGGGGTAGG + Intergenic
984559147 4:181248009-181248031 CTGAGAACCTAACAGGGTGTTGG + Intergenic
986155260 5:5168034-5168056 CTTAGATCCTTTTAGTATGTTGG + Intronic
986387882 5:7254584-7254606 CTGTGTTTCTTTCAGGTTGTAGG + Intergenic
986957418 5:13170518-13170540 CAGAGATACTTTCAGTGTTTGGG - Intergenic
987059112 5:14225475-14225497 TTCAGGTCCATTCAGGGTGTTGG + Intronic
987368969 5:17175675-17175697 CTGATATCTTTTCTGGGTCTGGG + Intronic
988785666 5:34563841-34563863 CTGAGATCCTCTCTGGAGGTAGG + Intergenic
990397598 5:55399355-55399377 CTGAGAAACTTTCAGGGTCTTGG - Intronic
998529307 5:142870454-142870476 CTGAGATCCTTGTAGTATGTGGG - Intronic
999941504 5:156547977-156547999 CTCAGATCCTTTCTGGGCTTTGG + Intronic
1000959312 5:167580520-167580542 CTAAGAGGCTTTCAGTGTGTGGG - Intronic
1004392829 6:15223647-15223669 CAGAGATCCTTTTGGGGTGGGGG + Intergenic
1004603845 6:17175803-17175825 TTGAGAACCTTTCAGCTTGTCGG + Intergenic
1004716964 6:18227148-18227170 CACAGACCCTTTAAGGGTGTCGG - Intronic
1007109816 6:39306710-39306732 CTCAGCTCCTTGCAGGCTGTGGG + Intronic
1007758862 6:44120029-44120051 CTGACAGCCTTACAGAGTGTAGG - Intronic
1008344616 6:50411153-50411175 CTGAAACCCTTTCAGAGTTTGGG + Intergenic
1009540176 6:64944630-64944652 CACAGACCCTTTAAGGGTGTTGG - Intronic
1011229617 6:85145762-85145784 CTGAGGGCCTGTCAGGGGGTGGG - Intergenic
1015142267 6:129948609-129948631 CTGGGATGTTTTCAGGTTGTAGG + Intergenic
1018465176 6:164037782-164037804 CTGAGAGCCTTTTAGGGAGATGG + Intergenic
1019195057 6:170276419-170276441 CCGAGGGCCTTTCAGGGTGGAGG + Intergenic
1021062148 7:16126477-16126499 CTGACTTCCTTTCATGGTATTGG - Intronic
1021468341 7:20971326-20971348 CTGAGTTCCTCCCAGTGTGTTGG + Intergenic
1021769649 7:23985451-23985473 CTGAGGTCTTTTCAGGGAGAAGG - Intergenic
1022098788 7:27157011-27157033 CAGAGACCCTTCCAGGGTCTGGG - Intronic
1025829398 7:65036756-65036778 CTGAGGTCCTCTCTGGCTGTTGG - Intergenic
1025916616 7:65871696-65871718 CTGAGGTCCTCTCTGGCTGTTGG - Intergenic
1028394458 7:90352113-90352135 ATGAGCTCCTTTCAGTGTTTAGG - Intronic
1029595702 7:101536517-101536539 CTGGGATCCTAGCAGGGTGAAGG + Intronic
1030740870 7:113108426-113108448 CTGAAATCCATTCAGTGTCTAGG - Intergenic
1031769541 7:125826204-125826226 CTGAGACATTTTCAGGGTTTTGG + Intergenic
1033019205 7:137705416-137705438 CTGAGATTCATTCATGTTGTTGG - Intronic
1033468985 7:141626435-141626457 CTGAGATACTTTGAGACTGTGGG - Intronic
1033790248 7:144784221-144784243 CCGAGATCATTTCCAGGTGTGGG - Intronic
1034213197 7:149382923-149382945 CTGAAGTCCTTTCTGGTTGTAGG - Intergenic
1035231744 7:157469686-157469708 GTCAGCTCCTTCCAGGGTGTAGG + Intergenic
1036240515 8:7076825-7076847 CTGAGATTCCTTCTGTGTGTAGG - Intergenic
1037037797 8:14189527-14189549 CTGAGAACATGTCAGGGTGAAGG - Intronic
1040027613 8:42796231-42796253 CAGAGACCCTTTACGGGTGTCGG + Intronic
1043143858 8:76625795-76625817 TGGAGATCCTTGCAGGCTGTTGG - Intergenic
1043505182 8:80895500-80895522 CTCAGATCCTTGCTGGCTGTTGG - Intergenic
1045415040 8:101957828-101957850 CTGAGACCCTACCAGGCTGTTGG + Intronic
1046788280 8:118291885-118291907 CTGAGTGCCTAACAGGGTGTTGG - Intronic
1048904941 8:139078443-139078465 CGGAGAGACTTTCAGGGTTTTGG - Intergenic
1049393621 8:142385225-142385247 CTGCCATCCTTTCAGGGTCTTGG - Intronic
1051760531 9:20458516-20458538 CTGAAATCCTATCAGGAGGTAGG + Intronic
1052502585 9:29311312-29311334 CGGAGAGCCTTTCAGGCTGGAGG - Intergenic
1052960311 9:34290320-34290342 ATGAGTTCCTATCATGGTGTAGG + Exonic
1054876172 9:70098418-70098440 CTAACATCCTTTTAGGGAGTGGG + Intronic
1057706390 9:97398081-97398103 CTGAGTTCCTTTCTGTCTGTTGG - Intergenic
1060165671 9:121412265-121412287 CTCAGTTCCTTTCTGGCTGTTGG + Intergenic
1062253178 9:135608505-135608527 CTGGGCTCCCCTCAGGGTGTGGG + Intergenic
1186091359 X:6052197-6052219 CAGAGATGCTATCAAGGTGTCGG - Intronic
1186260208 X:7769529-7769551 CTGAGGTCCTTTTTGGGTTTGGG + Intergenic
1186630060 X:11339117-11339139 CTGAGATTCTTTCAGGTGTTGGG - Intronic
1192577467 X:72254587-72254609 CTGAGATCCTTACCAGGTGAAGG - Intronic
1194436668 X:93875274-93875296 TTGACAGCCTGTCAGGGTGTCGG - Intergenic
1195081833 X:101378468-101378490 CTGAGCTCCACTCAGGGTGAAGG + Intronic
1195615455 X:106908480-106908502 CTGTAATCTTTTCAGGGTTTAGG + Intronic
1197394251 X:125907050-125907072 CTGAGGTCTTTTCAGGGGGAAGG + Intergenic
1197493753 X:127152693-127152715 CTGAGATTTTCTCAGGGTGAAGG + Intergenic
1198063908 X:133076724-133076746 CTCAGATCCTTACTGGTTGTTGG - Intronic
1200739106 Y:6833804-6833826 CTGAGATTCTTTCAGGTATTGGG + Intergenic