ID: 1154963176

View in Genome Browser
Species Human (GRCh38)
Location 18:21330006-21330028
Sequence ATGACCCCTTTGAAGACCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 89}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154963176 Original CRISPR ATGACCCCTTTGAAGACCTA GGG (reversed) Intronic
905391739 1:37640126-37640148 ATGCCCCATATGAAGAGCTATGG - Intergenic
907390966 1:54158071-54158093 CTGACCTCATTGAAGACCTCAGG + Intronic
908811417 1:67985536-67985558 ATCCCCCCTTTTAAGACCTTTGG + Intergenic
910233859 1:85013760-85013782 ACGACCCCCATGAAGACCCAAGG - Intronic
913371347 1:118103132-118103154 TTAACTCCTTTGAAGAGCTAGGG + Intronic
918365975 1:183807995-183808017 ATGACCCTTTTGAAGACAACTGG - Intronic
919162900 1:193853957-193853979 ATGACCCCTTTGCAGAACTTGGG - Intergenic
923188982 1:231601943-231601965 AGGACCTCTGCGAAGACCTAAGG - Intronic
1063129446 10:3165263-3165285 ACGACTCCTTTAAAGACCAAGGG + Exonic
1067743030 10:48910927-48910949 CTGAACCTTTTGAATACCTAAGG + Intronic
1069068910 10:63974331-63974353 ATGAGCTCTTTGAAGACGTCTGG - Intergenic
1073511190 10:104043573-104043595 ATGACCCCTCTGAAAACAGAAGG + Exonic
1074855879 10:117473125-117473147 CTGACCCCCTTGAAGACGAATGG + Intergenic
1077288175 11:1776817-1776839 AGGACCCCTGTGATGACCTGAGG + Intergenic
1083241546 11:61392458-61392480 ATGTCCCCTCTCCAGACCTAAGG - Exonic
1092215874 12:6681985-6682007 AAGACCCCTTTGTAAAGCTATGG - Intronic
1098503047 12:71216727-71216749 ATGACACCAGTGAAGACATAAGG + Intronic
1102697004 12:114807860-114807882 AGGACCCCTGTGATGATCTAGGG - Intergenic
1106254146 13:28007134-28007156 ATGATACATTTGAAAACCTAGGG - Intronic
1107612519 13:42130528-42130550 AATGCACCTTTGAAGACCTAGGG - Intronic
1120144493 14:80964669-80964691 AGGACACCTTTGAAGATCTAAGG - Intronic
1122242910 14:100381124-100381146 ATGGCTCCTGTGAAGACCCAGGG + Exonic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1129453190 15:75662144-75662166 ATGGCACATTTGAAGACCTTAGG + Exonic
1130176232 15:81574257-81574279 GTGACCCCTTTGGAGGCCTGAGG + Intergenic
1130723365 15:86411997-86412019 ATGTCTCCTTTAAAGACCTAGGG - Intronic
1131440443 15:92455519-92455541 ATAACCCCTTTTTACACCTACGG + Intronic
1131837088 15:96401739-96401761 ATGACCCCTTTGATGAGTTTGGG + Intergenic
1135910817 16:26559143-26559165 ATGAACCCTTGGAAGACAAACGG - Intergenic
1136673999 16:31882632-31882654 ATAACCAGTTTGAAGATCTATGG + Intronic
1139350944 16:66335052-66335074 ATGAGCCCATTGTAGACCTCAGG - Intergenic
1143412942 17:6723055-6723077 ATGACCATTTTGAAGGCCTCGGG - Intergenic
1149009970 17:51846122-51846144 ATGCCTCCTTTGCAGACCTGTGG - Intronic
1149588621 17:57810964-57810986 AGGACCCCAGTGAAGACCTCCGG - Intergenic
1150286817 17:63959422-63959444 AAGATGCCTGTGAAGACCTAGGG + Exonic
1154963176 18:21330006-21330028 ATGACCCCTTTGAAGACCTAGGG - Intronic
1159450254 18:68591955-68591977 ATGACACTTTTGAAGACATTGGG - Intergenic
1165521908 19:36321167-36321189 ATGACCCATCTGTAGACCTCAGG - Intergenic
1165574445 19:36802044-36802066 ATGACCCATCTGTAGACCTCAGG + Intergenic
1165633908 19:37324376-37324398 ATGACCCATCTGTAGACCTCAGG + Intronic
1167331751 19:48860400-48860422 CTGACACCTTAGAAGACCTGCGG - Exonic
925383519 2:3445755-3445777 ATGTCCCGTTTGAAGACAGAAGG + Intronic
927308377 2:21599770-21599792 ATTTCCCCTTTGAATTCCTATGG + Intergenic
928187851 2:29130198-29130220 AAGACCCCTGTGAAGCCCCAAGG - Intronic
928917011 2:36483196-36483218 CTGACCCCTGTGAAGAGCTAGGG + Intronic
931791942 2:65671582-65671604 ATGACACCATTAAAGACCCAGGG - Intergenic
938238809 2:129727210-129727232 ATGACCGCTACGAAGACCTCTGG - Intergenic
943009129 2:182425130-182425152 ATTACCCCTTTGGAGAGCTGTGG - Intronic
946572209 2:221036524-221036546 ATGACCCCTTTGAAAATAAAAGG + Intergenic
947389203 2:229622339-229622361 ATGACCCCTTTGACCCCCAAAGG + Intronic
1172131934 20:32661688-32661710 ATGACCCCTTTGCACAGCTCTGG - Intergenic
1172672113 20:36641725-36641747 ATCACTCCTTTGAATTCCTATGG + Intronic
1180020142 21:45118738-45118760 ATCACCCCTTAGAAAACCTCAGG + Intronic
1181947924 22:26532729-26532751 TAGTCCCCTTTCAAGACCTAAGG + Exonic
1183875740 22:40779228-40779250 CTGACCTCTTAGGAGACCTAAGG + Intronic
1203329817 22_KI270738v1_random:70744-70766 ATGACTCCTTTGAAGCCCAGTGG - Intergenic
951060366 3:18199758-18199780 ATGCCCCCTTAAAAGACATAGGG - Intronic
959586875 3:108033198-108033220 CCTACCCCTTTGAAGACCGATGG + Intergenic
962195819 3:133362505-133362527 ATGACCCTACTGAAGACCAAGGG + Intronic
966686309 3:182699455-182699477 TTGACCCCTTTGAAAACTTTAGG + Intergenic
967031672 3:185613339-185613361 TTTTCCCCTTTGAACACCTAAGG - Exonic
971277033 4:25208358-25208380 ATGTCCCCTAGGAAGACCTCTGG - Intronic
975063077 4:70027706-70027728 ATGACCTCTGTGAAGATATATGG + Intergenic
979975821 4:127195243-127195265 ATGATCTCTTTGAAAAACTATGG - Intergenic
982514804 4:156331715-156331737 ATGACCCCATTGAAAACCAAAGG - Intergenic
982712748 4:158773768-158773790 AAGACCCCTCTGAAAACTTAAGG - Intronic
982796478 4:159651429-159651451 TTGGCCACTTTGAAAACCTATGG - Intergenic
985890744 5:2713674-2713696 ATTACCTCTTAGAAGACATAAGG - Intergenic
990225920 5:53653312-53653334 ATGTCCACTTTGATGACTTAAGG - Intronic
990567956 5:57048924-57048946 AAGACCTCTTTGAAGACCTGAGG + Intergenic
995892622 5:116972668-116972690 GTGATCCCTCTGAAGATCTATGG - Intergenic
997336657 5:133113431-133113453 AGGACCCCACTGAAGACCTATGG - Intergenic
998965084 5:147530584-147530606 ATGGCACCTATGAAGGCCTAAGG + Intergenic
999716117 5:154361687-154361709 ATGGCCTCTTTTAATACCTATGG - Intronic
1001971135 5:175955930-175955952 ATCACCCATTTGTAGAGCTAAGG - Intronic
1002246307 5:177887847-177887869 ATCACCCATTTGTAGAGCTAAGG + Intergenic
1002292113 5:178206999-178207021 AAGACCCCATTGAAGACAGAGGG - Intronic
1008306359 6:49906055-49906077 ATGACTCCTCTGAAGAACTTAGG - Intergenic
1008908221 6:56704331-56704353 ATGATCTCTATGAAGACTTAAGG - Intronic
1010905340 6:81479948-81479970 ATTACCCTATTGAAGACCTTAGG - Intergenic
1012759711 6:103283179-103283201 GTGAACCCTTAGAAGACCTAAGG + Intergenic
1017755678 6:157527066-157527088 AGGACCCCTTTGAGAATCTATGG + Intronic
1020097357 7:5376503-5376525 AGGACCACTGTGAGGACCTAGGG + Intronic
1023915464 7:44585364-44585386 ATTACCACTTTGCACACCTAAGG - Intergenic
1032704237 7:134408335-134408357 ATGAGACCTTTGGAGACCTTGGG + Intergenic
1036760607 8:11506240-11506262 ATGTCCTATTTGCAGACCTAGGG + Intronic
1038850854 8:31274904-31274926 ATGACCCCATGGTAGATCTAAGG - Intergenic
1041111887 8:54490777-54490799 AAGACTCCTTTGAAAATCTAAGG - Intergenic
1044274897 8:90287731-90287753 ATGACCTCTTTGAAGAATCAAGG - Intergenic
1056576752 9:87860268-87860290 ATGACCACCTGGATGACCTAAGG - Intergenic
1058420758 9:104831056-104831078 CTGACCCCTTTGAGGACATGCGG - Exonic
1058911434 9:109523543-109523565 AGGACTCCTTTGAAGACTCAAGG + Intergenic
1059753071 9:117267207-117267229 ATGACACCTTTGAAGATCACTGG - Intronic
1060754314 9:126201351-126201373 ATGACCCACTAGAAGAGCTAAGG + Intergenic
1187810322 X:23169090-23169112 ATGAACCCTTTGAGGAGATAAGG + Intergenic
1193587645 X:83345463-83345485 ATGACCCCATTGAGGACAGATGG + Intergenic
1196729032 X:118922605-118922627 ATGACCCCTTTTCAGAAGTATGG + Intergenic
1197905871 X:131425038-131425060 ATGAACCCATAGAAGACCTGGGG - Intergenic