ID: 1154964370

View in Genome Browser
Species Human (GRCh38)
Location 18:21341923-21341945
Sequence AGCTGAACTGCTTTTGTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 1, 2: 2, 3: 18, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154964361_1154964370 29 Left 1154964361 18:21341871-21341893 CCCTATTAGGCTTTGACAAAACG 0: 1
1: 0
2: 0
3: 9
4: 61
Right 1154964370 18:21341923-21341945 AGCTGAACTGCTTTTGTTGGTGG 0: 1
1: 1
2: 2
3: 18
4: 158
1154964362_1154964370 28 Left 1154964362 18:21341872-21341894 CCTATTAGGCTTTGACAAAACGA 0: 1
1: 0
2: 0
3: 6
4: 79
Right 1154964370 18:21341923-21341945 AGCTGAACTGCTTTTGTTGGTGG 0: 1
1: 1
2: 2
3: 18
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154964370 Original CRISPR AGCTGAACTGCTTTTGTTGG TGG Intronic
902693277 1:18123837-18123859 AGATGAAGTGCATTTGCTGGAGG + Intronic
904023205 1:27484216-27484238 AGGTGGACTGGTATTGTTGGAGG - Intronic
904404775 1:30279256-30279278 AGCTGAACAGCTCTAGTAGGGGG + Intergenic
904559020 1:31384494-31384516 AGCAGAACTGTTTTCGGTGGAGG - Intergenic
907834680 1:58097766-58097788 AGCTCAACTGCTGTGGTGGGAGG + Intronic
911552941 1:99306355-99306377 AGCAGAGCTGCTTTTGGGGGAGG - Exonic
911603757 1:99876762-99876784 AGATGAACTTCTTTTTTTGTTGG - Intronic
911615269 1:100004008-100004030 AGGTGAACTGCATTTCTTGTAGG + Intronic
911756660 1:101565463-101565485 AGCAGAGCTGGTTTTTTTGGAGG + Intergenic
913444077 1:118931365-118931387 AGCTGAAATACATTTGTAGGTGG + Intronic
918104536 1:181405172-181405194 ACCTGAAGTGATTTTCTTGGAGG - Intergenic
918671714 1:187224921-187224943 CACTGCACTGCTTTTGTTAGGGG + Intergenic
919986743 1:202681021-202681043 AGCTGGACTGCATTTGAGGGAGG - Intronic
921775139 1:219089034-219089056 AGCTGCACTGCCTGGGTTGGGGG - Intergenic
922642155 1:227245186-227245208 AGCTGCACTGCCTGGGTTGGGGG - Intronic
1062884534 10:1006253-1006275 AGCAGAACAGCTTTTGCAGGAGG + Intronic
1064180868 10:13113401-13113423 AGCAGAACTGCTCTGGTTGTAGG + Intronic
1065928674 10:30459124-30459146 GGCTGAACTGCATTCGTTGCAGG + Intronic
1067257852 10:44661638-44661660 AGCTGCTTTGCTTTTGTTGCCGG - Intergenic
1069388734 10:67910008-67910030 GGCTGAACTGTTTTTTTAGGTGG + Intronic
1070288099 10:75098283-75098305 AGATGAGCTGCTTAGGTTGGTGG - Intronic
1070668615 10:78362680-78362702 TGCTGATCTTCTTTTGCTGGAGG + Intergenic
1071054819 10:81497200-81497222 AAATGAACTGGTTTTTTTGGTGG - Intergenic
1074100079 10:110347996-110348018 ATCTGAATTGTTTTTGTTTGAGG + Intergenic
1074397120 10:113107355-113107377 GGCTTAACTTCTTTTGTGGGAGG - Intronic
1075419545 10:122290594-122290616 AGCTGAACTGCCTTGGCTAGGGG - Intronic
1078936959 11:15960545-15960567 AACTGAACTGCTTTTGAGAGGGG + Intergenic
1079722300 11:23832892-23832914 AGCTGTAATCCTTTTGCTGGTGG + Intergenic
1083135323 11:60668970-60668992 AGCTGTAATGTTTTTGCTGGTGG - Intergenic
1087584417 11:100100201-100100223 ATCTGAAGTGCTTTTGTTTGAGG + Intronic
1089104169 11:115988204-115988226 AGCTGAGCTGCTGTAGTTAGAGG - Intergenic
1092333688 12:7608801-7608823 TGCTGCACTGCTGTTGTTGCTGG + Intergenic
1095131273 12:38545809-38545831 ATCTGTTCTGCTTTTGTTGGAGG + Intergenic
1095945747 12:47752265-47752287 AGGTGAACTGCCCCTGTTGGGGG + Intronic
1096379377 12:51142811-51142833 AGCTGAACTGTCTTGGTTGAAGG - Intronic
1097636666 12:62131088-62131110 AGCTCATTGGCTTTTGTTGGGGG + Intronic
1099745827 12:86703503-86703525 AGTTGAATTTTTTTTGTTGGTGG - Intronic
1100272548 12:93040104-93040126 AGCTGAAGTGCTTTCTTTGTTGG + Intergenic
1100297165 12:93273884-93273906 AGTTGGGCTGCTTTTGATGGTGG - Intergenic
1104261723 12:127189798-127189820 AGCAGACCTGCTTTTTTTAGGGG + Intergenic
1104874234 12:132021984-132022006 ACCTCAACTCCTTTTGTTGTTGG + Intronic
1105592095 13:21801833-21801855 AGCTGCACTACTTTAGTTGAAGG + Intergenic
1105792909 13:23820261-23820283 ATCTGACCTGCTTTTATTGTTGG - Intronic
1108780531 13:53825674-53825696 ATCTGGACTGCTTTTGTCTGTGG + Intergenic
1113818693 13:113194712-113194734 AGCTGAATTCTTTTTGGTGGGGG + Intronic
1114534000 14:23411841-23411863 GGCTGAACTTGTTTAGTTGGAGG + Intergenic
1115226324 14:31105825-31105847 TGGTGTACTGATTTTGTTGGAGG - Intronic
1117102177 14:52361021-52361043 AGCTGAACTCCATTTGTAGAGGG + Intergenic
1120426114 14:84350644-84350666 AGCTGCACTGCCTTGGTTTGGGG - Intergenic
1124209177 15:27748100-27748122 GGCTGACCTGGTATTGTTGGTGG - Intergenic
1126193074 15:45899499-45899521 AAAGGAACTGCATTTGTTGGTGG + Intergenic
1127893369 15:63274504-63274526 AGCAGCACTGGTTTTGTTGATGG - Intergenic
1128377064 15:67084568-67084590 TACTGAGCTTCTTTTGTTGGTGG + Intronic
1128925729 15:71653675-71653697 AGCAGAACTGCTTTGGTTGAAGG - Intronic
1130999968 15:88932128-88932150 AGGTGAACTGCTCTTGTTGGGGG + Intergenic
1132006384 15:98231683-98231705 AAATGAATTGCTTTTGGTGGTGG - Intergenic
1133509608 16:6444784-6444806 ACCAAAACTGCTTTTGTTAGTGG + Intronic
1133516053 16:6510320-6510342 ATTTGAACTGCTTTTGTTCGTGG + Intronic
1133596827 16:7302054-7302076 TTCTGTACTGCTTTTATTGGGGG - Intronic
1134809743 16:17157356-17157378 ATCTTCACTGCTGTTGTTGGTGG - Intronic
1136261103 16:29076699-29076721 AACTGAACAGTTTTTCTTGGGGG - Intergenic
1138078172 16:54063248-54063270 TGCTGAACTGCTGATGTTGGTGG + Intronic
1138878898 16:60986651-60986673 CTCTGAAGGGCTTTTGTTGGCGG - Intergenic
1140548970 16:75842994-75843016 AGTTGTAATGTTTTTGTTGGTGG + Intergenic
1140958523 16:79890172-79890194 GGATGAATTGCTTTTGATGGGGG - Intergenic
1141507759 16:84490124-84490146 TGCTGAACTGTTTTTATTTGTGG + Intronic
1141981166 16:87551220-87551242 ACCGGCCCTGCTTTTGTTGGAGG + Intergenic
1143329782 17:6125058-6125080 AGCTGAATTGCTGCTGTTGGAGG + Intergenic
1147192538 17:38746516-38746538 AGCTGAACTGCTTTTGTTGCTGG - Intronic
1148049344 17:44761457-44761479 AGTTGAACTGCTTGGGTTGGGGG + Intronic
1150587628 17:66532869-66532891 AGCTGATCTGCTGCTGTCGGTGG + Intronic
1151431975 17:74069879-74069901 ACTTGAGCTGCTTGTGTTGGAGG - Intergenic
1154964370 18:21341923-21341945 AGCTGAACTGCTTTTGTTGGTGG + Intronic
1157977657 18:52343818-52343840 ATCTGATCTGCTTTGGTTGGGGG - Intronic
1160414403 18:78698101-78698123 AGCTGCACTGCCCTTCTTGGAGG + Intergenic
1160860771 19:1236547-1236569 AGCTGAACTTCTTGGGGTGGGGG - Intronic
1167515420 19:49920729-49920751 AGCTGAAACGCTCTGGTTGGCGG + Intronic
925534019 2:4896850-4896872 AGCTGAACTCTTTTTGTTGTTGG - Intergenic
927473704 2:23396201-23396223 AACTCAACTGCCATTGTTGGTGG + Intronic
927509001 2:23632625-23632647 AGCAGAAGTGCATTTGTTGCGGG - Intronic
928145846 2:28774867-28774889 AGCAGAACTGCTTTTATTATGGG - Intronic
929702443 2:44175577-44175599 AGCTGAACTCCTTATGTGGCTGG + Intronic
930499152 2:52189590-52189612 AGGAGGACTGCTTTTTTTGGTGG + Intergenic
933310417 2:80653725-80653747 ATGTGATCTGCTATTGTTGGTGG - Intergenic
933643223 2:84786537-84786559 ATCTCAGCTGCTTTTGTTAGCGG - Intronic
935042288 2:99444204-99444226 AGCTGTACTTCTTTTGGTGGGGG - Intronic
936143303 2:109959914-109959936 TGTTGAACTGCTTATGTTTGTGG + Intergenic
936179991 2:110257880-110257902 TGTTGAACTGCTTATGTTTGTGG + Intergenic
942106686 2:172640686-172640708 AGGTAACCTGCTTTTGTTAGAGG + Intergenic
946433173 2:219636198-219636220 GGCTGCTCTGCTTTTGTTGGGGG + Intronic
947515075 2:230796474-230796496 AGTTGAACAGGTTTTGATGGAGG - Intronic
947820734 2:233067605-233067627 AGCTAAACTGTTTTCCTTGGTGG + Intronic
948190806 2:236057111-236057133 AGCTGACCTGACTTTTTTGGTGG + Intronic
1170491920 20:16886159-16886181 AGCAGATCTGGGTTTGTTGGAGG - Intergenic
1170578243 20:17680798-17680820 AGTTGGGATGCTTTTGTTGGGGG - Intronic
1171028070 20:21651079-21651101 TCCTGAACTTTTTTTGTTGGTGG - Intergenic
1177222291 21:18209976-18209998 AGCTGAACTGCCTTGGGTTGGGG + Intronic
1181140131 22:20798313-20798335 AGCTGACCTGCTTTTTTATGGGG - Intronic
1183075273 22:35422871-35422893 AGCAGGACTCCTTTTGTTGCTGG - Intronic
1184107169 22:42374667-42374689 ATCTGAACCACTTTGGTTGGTGG - Intergenic
1184667867 22:45998009-45998031 AGCTGAACTCTTTTTCTTTGGGG - Intergenic
950175576 3:10871524-10871546 AGCTGATTGGCTTTGGTTGGGGG + Intronic
956045319 3:65189950-65189972 AGCTGATCTGCTCTGGTGGGAGG - Intergenic
957777640 3:84774747-84774769 AGGTGAAGTACGTTTGTTGGAGG - Intergenic
958786739 3:98604630-98604652 AGCAGAGCTGCTTTTGTTGCAGG + Intergenic
960534290 3:118799640-118799662 AGTTCAACTGCTTTAATTGGGGG - Intergenic
961187440 3:124927971-124927993 AGCTGAGTTGCCTTGGTTGGTGG + Exonic
962475607 3:135752593-135752615 AGTTGACCTATTTTTGTTGGTGG - Intergenic
963764428 3:149319548-149319570 AGCTGCACTGATTTAGTCGGGGG + Exonic
963883302 3:150552472-150552494 ATCTAAAATGGTTTTGTTGGTGG + Intronic
964665249 3:159164771-159164793 AGCTGAACCTCTTTTTTGGGGGG - Intronic
965074539 3:163959705-163959727 AGCTGAACTGCTGTTAGTGGTGG - Intergenic
965516073 3:169622391-169622413 AAATGAACTGATTCTGTTGGCGG - Intronic
965612674 3:170561365-170561387 ACTTAAACTGCTTTGGTTGGTGG + Intronic
965840323 3:172897646-172897668 TGCTGAACTCATTTTTTTGGGGG + Intronic
966969292 3:185028081-185028103 AGCTGAAGAGCTTTTTTTAGTGG + Intronic
969984545 4:11194075-11194097 ACTTGAATTGGTTTTGTTGGTGG + Intergenic
972586279 4:40439523-40439545 AGCTAATCTGATTTTGATGGTGG + Intronic
973340753 4:49001401-49001423 TCCTTAACTGCTTTTGTTTGAGG - Intronic
975026978 4:69561583-69561605 AGCTGAAGTGTTTTTCTTGCAGG - Intergenic
975064432 4:70042929-70042951 TGTTTAACTACTTTTGTTGGGGG + Intergenic
975409653 4:74035503-74035525 ATCTGAACTGATTTTTATGGTGG - Intergenic
976219120 4:82741875-82741897 AGGTGAAGAGCTTTTGTTGGGGG + Intronic
977769828 4:100845222-100845244 AATTTAACTACTTTTGTTGGAGG - Intronic
977775161 4:100909522-100909544 AACTGAAGAGTTTTTGTTGGGGG + Intergenic
978404423 4:108364221-108364243 AACTGAGCTGCTTTTGGTGGTGG + Intergenic
978757610 4:112320666-112320688 TCCTGAACTTTTTTTGTTGGTGG + Intronic
979119480 4:116878944-116878966 AAATGAACTGCTTTTGTGGATGG + Intergenic
980851982 4:138394149-138394171 TGCTGAACTGTGTTTGTGGGTGG + Intergenic
981707661 4:147678647-147678669 AGCTGACCTGCTTTTCTTCTGGG + Intronic
983437525 4:167733911-167733933 AGCTAAGCTGCTTTTTTTGTGGG - Intergenic
989774202 5:45183159-45183181 AGCATAAATGCTTTTGTAGGGGG - Intergenic
990962767 5:61412228-61412250 AGTTGAACTGCTTTTTATGCAGG + Intronic
993989819 5:94642080-94642102 AGATGCACTGCTTCTCTTGGAGG - Intronic
995268698 5:110195372-110195394 AGCTGCACTGCCTGGGTTGGGGG + Intergenic
1003790577 6:9542601-9542623 AGCTGAATTGCATTTCTTGGTGG + Intergenic
1004821269 6:19370677-19370699 AGCTGATCTGATTTTTTTGAAGG + Intergenic
1006283524 6:33076147-33076169 AGCCGAACTGCCATTCTTGGAGG + Intronic
1007708298 6:43804912-43804934 AGCTGAGCAGATTTTGGTGGGGG + Intergenic
1011485250 6:87834370-87834392 AGCTCAACTTCTTTCCTTGGGGG - Intergenic
1011551636 6:88535871-88535893 GGCTGAACCTCTTTTGTTGTAGG - Intergenic
1013781405 6:113732606-113732628 ATCTCTGCTGCTTTTGTTGGAGG - Intergenic
1016040836 6:139430509-139430531 TTCTGAACTGTTTTTGTGGGTGG - Intergenic
1016387339 6:143541500-143541522 ACCTATACTGCTTTTTTTGGAGG - Intronic
1017467611 6:154708894-154708916 AGCAGAAGTGCTATGGTTGGTGG - Intergenic
1021123670 7:16825963-16825985 AGCTGCACTGCTGGGGTTGGGGG - Intronic
1023079048 7:36510780-36510802 AGCTGATCTGCTTTTTCTGGGGG + Intergenic
1029224930 7:99019144-99019166 AGCTGCAGTGCTTATGGTGGTGG + Intergenic
1029535547 7:101155214-101155236 AGGAGAACTGATTTTTTTGGTGG - Intronic
1029677526 7:102080621-102080643 TGGTGAACTGCTTTTCTTGTAGG - Intronic
1030673126 7:112358898-112358920 TGATCATCTGCTTTTGTTGGTGG - Intergenic
1034293014 7:149947341-149947363 TTCTGAACTGCTCTTCTTGGGGG - Intergenic
1034813059 7:154149532-154149554 TTCTGAACTGCTCTTCTTGGGGG + Intronic
1035988233 8:4457960-4457982 AGATGTACTTCTTTGGTTGGTGG + Intronic
1037531609 8:19780881-19780903 AAATAAAGTGCTTTTGTTGGTGG - Intergenic
1041864114 8:62549316-62549338 TGCTGCACTTCTTTTTTTGGGGG + Intronic
1042792596 8:72625003-72625025 AAAGGATCTGCTTTTGTTGGTGG - Intronic
1046036146 8:108843817-108843839 AGCAGATCTCCTTTTCTTGGAGG - Intergenic
1047106385 8:121734954-121734976 AGTTGTAATCCTTTTGTTGGTGG + Intergenic
1047690549 8:127349307-127349329 AGCAGAACTGCTTTCGTTCTTGG + Intergenic
1048280500 8:133102307-133102329 AGCTGCACTGCATGTGTTTGTGG - Intronic
1049054393 8:140224005-140224027 AACTGATCTGTTTCTGTTGGTGG + Intronic
1049920662 9:360859-360881 AGCTGAAATGCTCTTTTTGAGGG - Intronic
1050731948 9:8718819-8718841 AACTGAAACGCTTTTGTGGGAGG - Intronic
1051026269 9:12615456-12615478 AGTTAAACTGGTTTTGTTGCTGG + Intergenic
1052339254 9:27349189-27349211 AGCTTAACTGGCTTTGCTGGTGG + Intronic
1052636830 9:31117262-31117284 ATCTGAACTGCTTTCCATGGTGG + Intergenic
1053194824 9:36108944-36108966 AGCTGAACTACTATGGTTGAAGG - Intronic
1060523873 9:124309527-124309549 AGCTGCACTGCTGGTGATGGGGG - Intronic
1061408256 9:130404515-130404537 AGCTGCCCTGCTTTTGTTCCTGG + Intronic
1061755142 9:132807158-132807180 AACTGAACTGCTTTAGCTGTTGG + Intronic
1190808416 X:53861316-53861338 AGCTGCACTGCCTGTGCTGGGGG + Intergenic
1190922458 X:54868219-54868241 AGCTGAAGTGAGTCTGTTGGAGG + Intergenic
1192304507 X:69944622-69944644 AGCTGCACTGCTTTTGGTTGAGG + Intronic
1192738114 X:73868070-73868092 AGGTGAAGTGCATTTGTTGTAGG - Intergenic
1194381576 X:93198407-93198429 AGATGAACTTCTTTTGTATGTGG - Intergenic
1195292748 X:103444772-103444794 AGCTGAAACTCTCTTGTTGGTGG + Intergenic
1197580767 X:128280663-128280685 AGCAGAACTGCTTTTGTTGAAGG - Intergenic
1198319664 X:135507405-135507427 ACCTGGAGTGATTTTGTTGGTGG + Intergenic
1201964643 Y:19718707-19718729 TTCTGAACTGGTTTTTTTGGGGG - Intronic