ID: 1154964957

View in Genome Browser
Species Human (GRCh38)
Location 18:21347397-21347419
Sequence AAGGAGCAGCAGAAGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1611
Summary {0: 1, 1: 1, 2: 10, 3: 182, 4: 1417}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154964957_1154964959 -5 Left 1154964957 18:21347397-21347419 CCTTCCTGCTTCTGCTGCTCCTT 0: 1
1: 1
2: 10
3: 182
4: 1417
Right 1154964959 18:21347415-21347437 TCCTTCTCCATCTTCTTTGCTGG 0: 1
1: 4
2: 17
3: 98
4: 636

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154964957 Original CRISPR AAGGAGCAGCAGAAGCAGGA AGG (reversed) Intronic
900157514 1:1209142-1209164 AACCAGCTGCAGAGGCAGGAGGG + Intergenic
900868906 1:5287977-5287999 ACCGAGTAGCAGAAGGAGGAAGG - Intergenic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901110262 1:6787639-6787661 AAGCAGCAGCAGAAGAATCACGG + Intronic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
901604721 1:10450175-10450197 AAGGAAGAGCAGCAGCAGGGTGG + Exonic
901905232 1:12403222-12403244 AAGGAGTAGCAGGAGTAGCATGG - Intronic
901916119 1:12502007-12502029 AAGAAGGAGCAGAGGCTGGAAGG + Intronic
902397484 1:16140249-16140271 GAGGGTCTGCAGAAGCAGGATGG - Intronic
902726702 1:18340959-18340981 AAGAAGAAGGAGAAGAAGGAGGG - Intronic
902783922 1:18721025-18721047 CGGGAGCAGCAGCAGCAGGCAGG + Intronic
903029122 1:20450261-20450283 AAGGTGCAGGAGGGGCAGGAGGG + Intergenic
903187450 1:21636849-21636871 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
903190617 1:21653672-21653694 TAGTAGCAGCAGCAGCAGCAGGG + Intronic
903286185 1:22278198-22278220 AAGGAGCAAGAGAAAGAGGATGG + Intergenic
903384884 1:22919695-22919717 AGGGAGCAGGAGAGGGAGGAGGG + Intergenic
903407101 1:23106986-23107008 AAGGAGCAGCAGATGAGTGATGG - Intronic
903436947 1:23357120-23357142 TAGGAACAGGAGAAGCAGGCAGG + Intergenic
903575795 1:24339019-24339041 ATGAAGCAGCAGCAGCAGTATGG - Intronic
903741754 1:25562518-25562540 ATGGAGCTGCAGAAGCTGCAGGG + Intronic
903842968 1:26257620-26257642 AAGGACCAAAAGCAGCAGGATGG - Exonic
903959213 1:27046213-27046235 AAGGAGGAGAAGAAGAAGGTGGG - Intergenic
904012550 1:27398183-27398205 AAAGAGCAGGGGAAGAAGGATGG + Intergenic
904087181 1:27917090-27917112 AAGAAGCAGGAGGAGGAGGAGGG - Intergenic
904120322 1:28193924-28193946 AATGAGCAGCAGCAGGATGAAGG + Intronic
904268518 1:29332442-29332464 AAGGAGGACCAGAACCTGGAAGG - Intergenic
904295184 1:29515711-29515733 GAGGAGCAGGAGGAGGAGGAGGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904348510 1:29889849-29889871 AAGGAGCAGGAGAAATGGGAAGG + Intergenic
904358825 1:29959488-29959510 AAGGAGGACCAGCAGCAGGCAGG + Intergenic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
905288185 1:36900295-36900317 GAGGAGGAGGAGGAGCAGGAGGG - Intronic
905402782 1:37715711-37715733 CAGGAGCAGTAGAACCAGGGAGG - Intronic
905589132 1:39147028-39147050 GAGGAGGAGAAGAAGAAGGAAGG - Intronic
906052714 1:42888035-42888057 CACGAGCAGCAGCAGCAGGAAGG + Intergenic
906109396 1:43312934-43312956 AAGGAGAAGCAGAAGCTTGAGGG + Intronic
906114966 1:43350338-43350360 AAGAAGCAGCAGATGAAGGATGG - Intronic
906124442 1:43418835-43418857 AAAGAGCAGCAGCAGGAGGAGGG + Intronic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906180866 1:43817681-43817703 AAGAAGGAGAAGAAGAAGGAAGG - Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906557769 1:46728186-46728208 AAGGGCCAGCTGAAGCAGGGTGG + Intergenic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
906647592 1:47486872-47486894 AAGGAAAAGAAAAAGCAGGAAGG - Intergenic
906708081 1:47909540-47909562 AAGGAGGAGAAGAAGGAAGAAGG + Intronic
906728498 1:48061416-48061438 AAAGAGCAGCAGAAAAAGCAAGG + Intergenic
907306899 1:53518244-53518266 GAGGAGCAGCACTAGCAGCAGGG + Intronic
907583193 1:55590483-55590505 AAGAAGCAGCAGCTGCAGCAAGG - Intergenic
907684840 1:56600508-56600530 CTGGAGTAGCAGCAGCAGGAAGG + Intronic
907736798 1:57121199-57121221 AAGGAGAAGAAGGAGAAGGAGGG + Intronic
907751628 1:57268915-57268937 AAGGATTAGCAAGAGCAGGAAGG + Intronic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
907894545 1:58673872-58673894 CAGGAGCACCAGTAGCAGGTGGG + Intronic
908340545 1:63173941-63173963 AGAAAACAGCAGAAGCAGGAGGG + Intergenic
908397870 1:63742817-63742839 AAGGAGAAGATGAAGCAGGGAGG + Intergenic
908418437 1:63935729-63935751 AAACAGCAGCTGGAGCAGGAAGG + Intronic
908432573 1:64073317-64073339 AAGGAGCACATGGAGCAGGAAGG - Intronic
908651139 1:66334485-66334507 AAGGAGGAGCGGAAGCCTGAGGG - Intronic
908809016 1:67960091-67960113 GAGGAGCAGCAGGATCAGGAGGG - Intergenic
908825979 1:68133064-68133086 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
908844124 1:68307190-68307212 AGAAAACAGCAGAAGCAGGAAGG - Intergenic
909170026 1:72282963-72282985 CAGCAGCAGCAGAAGCAGCGCGG + Intergenic
909292754 1:73904548-73904570 AGGGAGCAGGAGAGGAAGGAGGG + Intergenic
909344887 1:74573169-74573191 AGGGAGCAGCAGAAGCAGAAGGG - Exonic
909546792 1:76857282-76857304 AAGGGGTAGCAGCTGCAGGAAGG - Intergenic
909694421 1:78450056-78450078 CAGGTGCAACAGAAGCAGCATGG - Intronic
909829070 1:80162590-80162612 AGGAAACAGCAGAAGGAGGATGG + Intergenic
910364216 1:86446745-86446767 AAGGAGCAGCAGCAGAAGTCAGG + Intronic
910593552 1:88953885-88953907 AAGAAGAAGAAGAAGAAGGAGGG - Intronic
910783962 1:90973905-90973927 AGAAAACAGCAGAAGCAGGAAGG + Intronic
910806184 1:91191632-91191654 AAGGAACAGCAAAAGGAGAAAGG - Intergenic
910820218 1:91337860-91337882 AAGGAGGAGGAGAACCAAGAGGG + Intronic
911054423 1:93698121-93698143 AGGCAGCAGCGGAAGCAGGATGG + Intronic
911474312 1:98357485-98357507 AAGGAGGAGGAGGAGAAGGAGGG - Intergenic
911530626 1:99039398-99039420 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
911632570 1:100199742-100199764 GAGGGCCAGCAGAAGCAGGATGG + Intronic
911732853 1:101308234-101308256 AGGAAACAGCAGAAGCAGGAAGG + Intergenic
911820311 1:102411259-102411281 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
912039672 1:105372730-105372752 AAGGAGGAGAAGAAATAGGAAGG + Intergenic
912114514 1:106388638-106388660 AAGGAGAAGGAGAAGTAGTAGGG + Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912259143 1:108092051-108092073 AAAGAGGAGGAGAAGGAGGAAGG - Intergenic
912498481 1:110106568-110106590 AAGGAGCTGGAGCAGGAGGAAGG - Intergenic
912565773 1:110586174-110586196 CAGGAGCAGAAGAAGCAAGGGGG - Intergenic
913060106 1:115196906-115196928 AAGAAGCAGCACAATCGGGAAGG - Intergenic
913223401 1:116677636-116677658 GACGGGCAGCAGAAGGAGGAAGG - Intergenic
913318754 1:117574377-117574399 AAGCTGCAGGAGAAGGAGGATGG - Intergenic
913474331 1:119222649-119222671 AAGCAGCAGCAGATTCAGGGTGG + Intergenic
914196204 1:145449295-145449317 ATAGACCAGCAGATGCAGGAAGG - Intergenic
914826687 1:151142574-151142596 CAGCAGCAGCAGTAGCAGCAAGG + Exonic
914925986 1:151888125-151888147 AGGGAGTGGGAGAAGCAGGACGG - Intronic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915185788 1:154104261-154104283 TAGGAGGAGGAGAAGCAAGATGG + Intronic
915191870 1:154157604-154157626 AGGGAGGAGCAGCAGCAGGGTGG + Intronic
915275245 1:154783934-154783956 GAGGAGCAACAGGAACAGGAAGG + Intronic
915340110 1:155172837-155172859 AAAGAGCAGCAGGGACAGGAGGG + Exonic
915571805 1:156748960-156748982 AGGAAGCAGCAAAAGCAGAAAGG + Intronic
915713043 1:157919613-157919635 GTGGGGAAGCAGAAGCAGGAGGG - Intergenic
916091294 1:161309722-161309744 AAGAACAAGCAGGAGCAGGAAGG - Intronic
916138737 1:161675418-161675440 AGGGAGCAGCAGTGGGAGGATGG + Intronic
916199890 1:162260699-162260721 AAGGAGCAGCAAAAAAAGGTGGG - Intronic
916330928 1:163615911-163615933 ACTGTGCAGCAGATGCAGGATGG + Intergenic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916456104 1:164972443-164972465 AGGCAGCAGCAGAGGCAGAAGGG - Intergenic
916616266 1:166444252-166444274 AAGGAGAAGAAGAAGAAGAAAGG + Intergenic
916654118 1:166858259-166858281 AGGGAGCAGTAAAAGCTGGAGGG + Exonic
916822773 1:168415951-168415973 AAGGAAGAGCAGAGGCATGATGG - Intergenic
917171765 1:172184510-172184532 AATGAGCAGCACAATCTGGAGGG + Intronic
917256175 1:173118741-173118763 AGAAAACAGCAGAAGCAGGAAGG - Intergenic
917405894 1:174708489-174708511 AAGGATTAACAGAAGCAGGGTGG + Intronic
917521429 1:175751127-175751149 AGGGAGGAGCAGAACCAGGCTGG - Intergenic
917963573 1:180164906-180164928 AAGCAGGAGAGGAAGCAGGAGGG + Intronic
918080941 1:181207184-181207206 AAGGAGCAGGAGCCGCAGGCTGG - Intergenic
918301497 1:183208136-183208158 AAGGAGGAAAAGAAGAAGGAAGG + Intronic
918547012 1:185696517-185696539 TAGCTGCAGCAGAAGGAGGACGG - Intergenic
919016795 1:192048670-192048692 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919757849 1:201077046-201077068 GAAGAGCAGCAGCAGCAGGGAGG + Exonic
919822941 1:201484329-201484351 GAGGAGCAGCAGCAACAGGCTGG - Exonic
919988821 1:202694700-202694722 AAGGAAGAGGAGAAGGAGGAGGG - Intronic
920034494 1:203056988-203057010 TTGGGGCATCAGAAGCAGGAAGG + Intronic
920070781 1:203301510-203301532 AGGGAGAAGGAGAAGCAGGAAGG + Intergenic
920160838 1:203996665-203996687 TGGGAGAAGGAGAAGCAGGATGG + Intergenic
920521254 1:206628700-206628722 AAGGAGAAGAAGAAGAAGAAAGG + Intergenic
920618702 1:207522491-207522513 AATGGGCAGCTGAATCAGGACGG - Intronic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921394485 1:214654077-214654099 AAACAGCAGCAGGAGGAGGAGGG - Intronic
921397055 1:214679620-214679642 AAGGAGAAGAAGAAGAAGAATGG - Intergenic
921401543 1:214728659-214728681 AAAGAACACAAGAAGCAGGATGG - Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921707976 1:218345803-218345825 AAGGAGGAGCAGGAGAAGGAGGG + Intergenic
921718401 1:218443350-218443372 AAAGAGCAGCATAAGGAGGCGGG + Exonic
921764430 1:218953501-218953523 CAGCAGCAGCAGCAGCAGGAGGG + Intergenic
921812362 1:219529419-219529441 GAGCAGCAGCAGCAGCAGCAGGG + Intergenic
921945406 1:220882766-220882788 AAGCAGCAGGAGGAGGAGGAAGG - Intronic
922027710 1:221767137-221767159 CAGGAGTAGGAGAGGCAGGAGGG - Intergenic
922098638 1:222463921-222463943 AAAGAGCAGAATAAGGAGGATGG + Intergenic
922378584 1:224996828-224996850 AAGGCCCTGCATAAGCAGGAAGG - Intronic
922396719 1:225209845-225209867 AAGGGCGAGCAGAAGCAGGGTGG + Intronic
922651339 1:227341601-227341623 AAGGAGAAGCAGAGGGATGAGGG + Intergenic
922662972 1:227446486-227446508 TAGAAGGAGTAGAAGCAGGAGGG + Intergenic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
922732703 1:227959541-227959563 AAGGTGCAGCAGGACCCGGAAGG - Intergenic
922793112 1:228321509-228321531 AAGGAGATGAAGCAGCAGGAAGG + Exonic
922794658 1:228334143-228334165 AAGCTGCAGCAGTGGCAGGACGG - Intronic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923072437 1:230577889-230577911 AAGGAGAAGAAGAAGGAGAAGGG - Intergenic
923090348 1:230735767-230735789 AAGGAGAAGCAGTTTCAGGAAGG - Intergenic
923135998 1:231119759-231119781 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
923380432 1:233411917-233411939 AGGGAACTGCAGAAGCAGGAAGG + Intergenic
923521630 1:234739428-234739450 AAGGGGCAGCAGAAGGGGCATGG - Intergenic
923712014 1:236395453-236395475 AAGGAGGAGAAGAAGAAGGGAGG + Intronic
923760018 1:236833595-236833617 AGGGGGCAGTAGAAACAGGAAGG + Intronic
924670561 1:246120258-246120280 AACAAACAGCAGAAGCAAGAAGG - Intronic
924705686 1:246500074-246500096 AAGGAGCAGCAGCAGCAGCAGGG - Intronic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1063570423 10:7210401-7210423 ACTGGGCAGCAGAGGCAGGAGGG + Intronic
1064003528 10:11682675-11682697 AAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1064138995 10:12774428-12774450 AGGGAGCAGGGGAAGCAGGAAGG + Intronic
1064645341 10:17454199-17454221 CAGCAGCAGCAGCAGCAGGCTGG + Exonic
1065173843 10:23057898-23057920 AGGAAACAGCAGAAGCAGGAAGG - Intergenic
1065174299 10:23061979-23062001 AGTAAACAGCAGAAGCAGGAAGG - Intergenic
1065286510 10:24192406-24192428 AGAAAACAGCAGAAGCAGGAAGG - Intronic
1065474774 10:26122711-26122733 AAGGAGGAGAAGGAGAAGGAGGG - Intronic
1065516127 10:26526052-26526074 AGAAAACAGCAGAAGCAGGAAGG - Intronic
1065766642 10:29036543-29036565 CAGAAGGAACAGAAGCAGGAAGG + Intergenic
1065804317 10:29380833-29380855 GAGTAGCAGCAGGAGCTGGAAGG - Intergenic
1065905466 10:30247327-30247349 TAGGAGCAGTTGAAGGAGGAGGG - Intergenic
1065915285 10:30349909-30349931 AAGGGGCACCAGGAGCAGGCAGG + Intronic
1065944868 10:30597187-30597209 GAGTAGCAGCAGGAGCTGGAAGG + Intergenic
1065967048 10:30779070-30779092 AAGGAGGAGGAAGAGCAGGAGGG + Intergenic
1066017335 10:31260916-31260938 AAGGAGAAGGAGTAGTAGGAGGG - Intergenic
1066074081 10:31855000-31855022 GAGGAGGAGCAGGAGGAGGATGG + Intronic
1066169710 10:32828413-32828435 AAGGAGAAGAAGAAGAAGGAAGG + Intronic
1066368363 10:34798342-34798364 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1066638535 10:37532312-37532334 AGGACACAGCAGAAGCAGGAAGG - Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067239740 10:44480455-44480477 AAGGGCAAGCCGAAGCAGGAGGG + Intergenic
1067774945 10:49156682-49156704 ATGGGGCAGCAACAGCAGGAAGG + Intronic
1067842025 10:49688640-49688662 GAGGATAGGCAGAAGCAGGAGGG - Intronic
1068299186 10:55116737-55116759 AAGAAACAGCAGAAGCAGGAAGG + Intronic
1068510055 10:57954402-57954424 GAGGAGGAGGAGAAGAAGGAGGG - Intergenic
1068690201 10:59906444-59906466 AAGGAGGAGGAGCAGCAGGGAGG + Exonic
1068911212 10:62380290-62380312 AAGGAGGAGGAGAAACAGAAGGG - Intronic
1068933261 10:62612679-62612701 AAGGAGATGCAGAAGCAGGGGGG + Intronic
1068934466 10:62622399-62622421 AGGGAAAAGGAGAAGCAGGATGG - Intronic
1069040156 10:63687444-63687466 AGGAAACAGCAGAAGCAGGAAGG - Intergenic
1069095167 10:64250230-64250252 AAGGAGGAGCAAAGGCATGAAGG + Intergenic
1069109988 10:64435367-64435389 AGAAAACAGCAGAAGCAGGAAGG - Intergenic
1069420829 10:68245006-68245028 AGAAAACAGCAGAAGCAGGAAGG - Intergenic
1069546196 10:69330598-69330620 AGAAAACAGCAGAAGCAGGAAGG + Intronic
1069588872 10:69630023-69630045 AAGAAGGAGAAGAAGGAGGAGGG - Intergenic
1069668746 10:70183624-70183646 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1069840687 10:71337540-71337562 AAGCAGCAGCAGAGGCAGCTGGG - Intronic
1070110148 10:73478079-73478101 AAGGAGAAACAGAAGCACTAGGG + Intronic
1070267983 10:74923221-74923243 AAGGAGTAGGAGAAGTAGAAGGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070538022 10:77393888-77393910 CAGGACCGGCAGAAGCAGGCCGG + Intronic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1071264700 10:83954647-83954669 AACGAGGAAGAGAAGCAGGAAGG - Intergenic
1071358023 10:84817959-84817981 CAGCAGCAGCAGCAGCATGAGGG + Intergenic
1071397456 10:85237969-85237991 GAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1071598946 10:86946969-86946991 AAGGGGCTGCAGAAGGAGGCTGG + Intronic
1071798856 10:89035416-89035438 AAAAAATAGCAGAAGCAGGAAGG - Intergenic
1072047590 10:91672226-91672248 TAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1072092093 10:92138422-92138444 GAGGAGCAGCAGGAGGCGGAAGG + Intronic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072297493 10:94025151-94025173 AATCAGCAGCAGAAGAAAGAGGG + Intronic
1073103553 10:101019523-101019545 AGGCAGAAGCAGAAGCAGAAGGG - Intronic
1073340926 10:102744029-102744051 GCGGAGGAGCAGGAGCAGGAGGG + Exonic
1073385329 10:103122603-103122625 AGAAAACAGCAGAAGCAGGAAGG + Intronic
1074057309 10:109934106-109934128 AATAAGCAGCAGATGCAGCAAGG + Intergenic
1074532185 10:114305411-114305433 AAGGAGATGCAGATGCAGGAGGG + Intronic
1074532235 10:114305603-114305625 AAGGAGATGCAGATGCAGGAGGG + Intronic
1074532241 10:114305639-114305661 GAGGAGATGCAGATGCAGGAGGG + Intronic
1074532268 10:114305726-114305748 GAGGAGATGCAGATGCAGGAGGG + Intronic
1074532366 10:114306085-114306107 AAGGAGATGCAGATGCAGGAAGG + Intronic
1074532403 10:114306211-114306233 GAGGAGATGCAGATGCAGGAGGG + Intronic
1074544619 10:114393072-114393094 AAGGAGAGGAGGAAGCAGGAAGG + Intronic
1074732174 10:116390825-116390847 AAGGAGAAGAAGAAGAAGGAAGG + Intergenic
1074813863 10:117130510-117130532 AAGGAGAAACAGCTGCAGGAGGG - Intronic
1075175387 10:120155855-120155877 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1075486884 10:122829650-122829672 AAGCAGCTGCAGCAGCAGCAGGG - Intergenic
1075534979 10:123263289-123263311 AAGGAGGAGGAGGAGCTGGAGGG + Intergenic
1076290868 10:129344405-129344427 AAGAAGCAGAGGAAGGAGGAAGG - Intergenic
1076548435 10:131261448-131261470 AAATATCAGCAAAAGCAGGACGG + Intronic
1076568591 10:131415921-131415943 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1076587847 10:131561356-131561378 AAGGAGCAGGAGAGGCTGGCAGG - Intergenic
1076758402 10:132587362-132587384 TGGCAGCAGCAGAAGCAGGCTGG - Intronic
1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG + Exonic
1076939261 10:133590750-133590772 GTGGAGCAGAAGATGCAGGAAGG - Intergenic
1077063347 11:627108-627130 GAGCAGCAGCAGCAGCAGGAGGG + Exonic
1077194009 11:1270355-1270377 AAGGACCCACAGAGGCAGGATGG - Intergenic
1077219285 11:1408294-1408316 GAGGATCAGCAGGAGCTGGATGG - Intronic
1077532463 11:3103651-3103673 AGGGGGCAACAGAGGCAGGAAGG - Intronic
1077532481 11:3103710-3103732 AAGGGGCAGCAGAGCCTGGAAGG - Intronic
1077532508 11:3103827-3103849 AAGGGGCTGCAGAGGCTGGAAGG - Intronic
1077538213 11:3134516-3134538 AGGGACCAGCAGCAGGAGGAGGG - Intronic
1077631982 11:3817153-3817175 CAGGAGCAGCAGAGACAGGCAGG - Intronic
1078060685 11:8040703-8040725 AAGGAGCAGTAGGAGGAGGAGGG + Intronic
1078074796 11:8148794-8148816 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1078091263 11:8266088-8266110 AATGGGCTGCAGAAGCAGGTAGG + Intronic
1078148452 11:8738605-8738627 AAGAAGTAGCAGTAGCAGCAGGG - Intronic
1078294225 11:10049923-10049945 AATGAGCCTCAGAATCAGGAAGG + Intronic
1078473509 11:11610843-11610865 AAGGAGCTGCAGAGGAAGGGAGG - Intronic
1078544571 11:12237748-12237770 CAGGAGCAGCAGCAGCAGCTGGG + Intronic
1078567350 11:12427942-12427964 AAAGGGCAGCAGAACCTGGAGGG + Intronic
1078593372 11:12665231-12665253 AAGGAGCAGGAGGAGAAAGAAGG + Intergenic
1078759155 11:14237857-14237879 TAAGAGCAGCAGAAGTAGGAGGG + Intronic
1078766187 11:14300771-14300793 AAGGAGGAAAAGAAGAAGGAAGG + Intronic
1079170710 11:18092639-18092661 AAGTATCAGCAAAGGCAGGAAGG + Intronic
1079912488 11:26328692-26328714 CAAGAGCAGCAGAAACATGAAGG + Intronic
1080210629 11:29781110-29781132 AAGGGGCTACAGAAACAGGAAGG + Intergenic
1080394208 11:31875063-31875085 CAGGAGCAGCAGGAGGGGGAAGG - Intronic
1080394211 11:31875069-31875091 CAGTAGCAGGAGCAGCAGGAGGG - Intronic
1080394313 11:31875902-31875924 AGGAAGCTGCAGAAGGAGGAGGG - Intronic
1080756110 11:35200797-35200819 AAGAAGCTGCAGCAGTAGGAAGG - Intronic
1081035660 11:38142160-38142182 AAAGAACAGCAGTAGCAGAAAGG + Intergenic
1081465804 11:43315728-43315750 AAGGAGTAGCAGAGGCAGAGTGG - Intronic
1081567761 11:44270387-44270409 AAGGAACAGGAGAAGAAGGAGGG - Intronic
1081801080 11:45859766-45859788 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1082176511 11:49066254-49066276 CAGGAGCAGCAGAAGCTGTAAGG - Intergenic
1082616721 11:55370477-55370499 GAACAGCAGCAGAAGCAAGAGGG + Intergenic
1082828524 11:57598296-57598318 AGCCAGCAGCAGCAGCAGGAGGG - Exonic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1082892430 11:58154195-58154217 AAGGGGGAGGAGAAGGAGGAAGG + Intronic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1082928935 11:58579312-58579334 CCGGAGCAGCAGGACCAGGAAGG + Exonic
1083443223 11:62690456-62690478 AAGCAGGAGCAGGAGCAGGCAGG + Exonic
1083859389 11:65411867-65411889 ATGGAGCACCAGCAGGAGGAAGG - Exonic
1084065242 11:66700440-66700462 AAGGAGCAGGATGGGCAGGAAGG - Intronic
1084502741 11:69544517-69544539 AAGGAGGAGGAGAAGCAGGCAGG + Intergenic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084634072 11:70378659-70378681 ACGGAACAGCAGCAGCAGGGAGG - Intronic
1085011011 11:73141920-73141942 AAGGACCAGGAGGAGGAGGAGGG + Exonic
1085052893 11:73388888-73388910 ACGGGGCAGCACAGGCAGGAAGG - Intronic
1085666312 11:78417940-78417962 GGGGAGCAGCTGCAGCAGGAAGG + Intronic
1085844513 11:80049995-80050017 AAGGAGCATAAGAAAAAGGAAGG + Intergenic
1085908792 11:80797449-80797471 AAGCAGCAAAAGAAGAAGGAAGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086308110 11:85503935-85503957 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1086550992 11:88051423-88051445 TAGGTGGAGCACAAGCAGGACGG + Intergenic
1086582346 11:88413683-88413705 TAGGGGCAGCAGTAGCAGGGTGG - Intergenic
1086597256 11:88587598-88587620 AGAAAACAGCAGAAGCAGGAAGG + Intronic
1086689202 11:89769621-89769643 CAGGAGCAGCAGAAGCTGTAAGG + Intergenic
1086716656 11:90070350-90070372 CAGGAGCAGCAGAAGCTGTAAGG - Intergenic
1087126726 11:94635205-94635227 AAGAAGCAGCAGACACAGCATGG - Intergenic
1087129831 11:94659134-94659156 AAGAGGCAGCAGGAGCAGGTGGG + Intergenic
1087306485 11:96495482-96495504 AAGGAGGAGGAGGAGAAGGAGGG - Intronic
1087539186 11:99493059-99493081 AGGTAGCAGTAGAAGCAGGAAGG - Intronic
1087702335 11:101449474-101449496 AAGAAACAGCAGAAGCAGGAAGG + Intergenic
1088047610 11:105472782-105472804 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1088088636 11:106011297-106011319 AAGGAGCTGAAGTAGTAGGAAGG - Intronic
1088747997 11:112820575-112820597 GAGAAGCAGCAGATGCAGGAAGG + Intergenic
1088851748 11:113708963-113708985 AAGGCTCTGCACAAGCAGGAAGG + Intergenic
1089114123 11:116080374-116080396 AAGGAACAGCAGAGGGAAGAGGG - Intergenic
1089162300 11:116447978-116448000 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
1089561623 11:119346074-119346096 AAGCAGCAGGAGGAGCAGGCTGG + Exonic
1089664338 11:120008404-120008426 AGAAAACAGCAGAAGCAGGAAGG - Intergenic
1089788082 11:120922394-120922416 AGGGAGCAAAAGCAGCAGGATGG - Intronic
1089804998 11:121078739-121078761 CTAGAGCAGCAGAAGCAGTAAGG - Intronic
1089964904 11:122647876-122647898 AAGGAGGAGGAGAGGAAGGAAGG - Intergenic
1089965884 11:122655060-122655082 AAGGAGGAGGAGAAGAAGGAAGG - Intergenic
1090464611 11:126923030-126923052 AAGGAGGAGGAAAACCAGGAGGG - Intronic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090840035 11:130479392-130479414 AAGGAGCAGCAGCACCGGGCAGG - Intergenic
1091041446 11:132284979-132285001 AAGCATGAGCAGGAGCAGGAAGG + Intronic
1091363972 11:135001655-135001677 AAGAAGACGGAGAAGCAGGAAGG + Intergenic
1091635553 12:2194102-2194124 GAGGAGCAGGAGGAGGAGGACGG - Intronic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1092102492 12:5897207-5897229 AAGCAGCCAGAGAAGCAGGAAGG + Intronic
1092907622 12:13116338-13116360 AATGGGCAGCAACAGCAGGAGGG - Intronic
1093561971 12:20552511-20552533 GAGGAGGAGGAGCAGCAGGAGGG + Intronic
1093661170 12:21758608-21758630 CAGGAGCAGCAGGAGAAGTATGG - Intergenic
1093684353 12:22039612-22039634 AAGCAGCAGCACAAGTAGGCAGG + Intergenic
1093775328 12:23067138-23067160 AAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1094232411 12:28122324-28122346 AAGAAGCAGAAGAATGAGGAGGG + Intergenic
1094232910 12:28128386-28128408 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
1094303431 12:28991791-28991813 AAGGCCCAGCAGAAACAGGAGGG - Intergenic
1094363744 12:29658453-29658475 AATGATCAGGAGAAGAAGGAAGG - Intronic
1094387266 12:29908895-29908917 AAGGAGGAACAGAAGAAGGGAGG - Intergenic
1094686927 12:32726711-32726733 AAGCAGCAGCAGAAACACTAGGG - Intronic
1095223253 12:39645167-39645189 AGAAAACAGCAGAAGCAGGAAGG - Intronic
1095651776 12:44619647-44619669 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1096111323 12:49030933-49030955 AAGAAGCTGCGGAAGGAGGACGG - Exonic
1096187950 12:49595396-49595418 AAGGAGCAGGAAAACCAGAAGGG + Intronic
1096317925 12:50584950-50584972 ACGAAGCAGGAGAAGCAGGCAGG - Intronic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096537680 12:52286008-52286030 AAGGGGCCTCAGGAGCAGGAAGG - Exonic
1097053069 12:56235211-56235233 CAGGAGCCGCAGCAGCAGCAGGG - Exonic
1097543505 12:60970059-60970081 AAGCAGCAGCCTAAGCAAGAAGG - Intergenic
1097544447 12:60981540-60981562 CAGGAGTAGCATATGCAGGAAGG + Intergenic
1097616641 12:61891682-61891704 TAGGAGGAGGAGAAGGAGGAGGG + Intronic
1097973379 12:65659208-65659230 AAGGAGGAGGAGGAGAAGGAGGG - Intergenic
1098064600 12:66600541-66600563 AAAGAAAAGCAGAAGTAGGAGGG - Intronic
1098414970 12:70223072-70223094 AAGAAGCAGAAGCAGGAGGAAGG - Intergenic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098622072 12:72613758-72613780 GAGAAGGAGCAGAAGGAGGAGGG + Intronic
1098630174 12:72713341-72713363 AAGAAGGAGGAGAAGAAGGAAGG + Intergenic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1099239015 12:80116345-80116367 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1099363106 12:81731023-81731045 TAAGAGCAGCAGTACCAGGATGG - Intronic
1099473296 12:83076773-83076795 AGGGAGAATTAGAAGCAGGAGGG - Intronic
1099533166 12:83812483-83812505 AAGGAGCAAAAGCAGAAGGAAGG - Intergenic
1100037506 12:90270901-90270923 AAAAAGCAGCAGGAGAAGGAAGG - Intergenic
1100201240 12:92299896-92299918 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1100280502 12:93113794-93113816 GAGAAACAGCAGATGCAGGAAGG - Intergenic
1100415543 12:94369884-94369906 AAGCAGCAGCAGCAGCAGCAAGG + Intronic
1100449926 12:94696063-94696085 GAGGAGCAGCAGCAGGGGGAAGG + Intergenic
1100454857 12:94742061-94742083 AAGGACCAGGAGTGGCAGGAAGG + Intergenic
1100550736 12:95644376-95644398 AAGGAGAAGAAGAAGGGGGAAGG - Intergenic
1100717724 12:97323465-97323487 AGAGAACTGCAGAAGCAGGAAGG - Intergenic
1101572047 12:105962646-105962668 AAGAAGTAGTAGAAGCAGTAAGG + Intergenic
1101726477 12:107392443-107392465 AATGAGAAGCAGAGGCAGGGAGG - Intronic
1102044509 12:109821451-109821473 AAAGAGCAGGGGAAACAGGAGGG - Intronic
1102050407 12:109857739-109857761 AAGGAGCAGGAGATGCCGGTAGG - Intronic
1102492425 12:113297330-113297352 CAGGAGCCGCAGTGGCAGGATGG + Exonic
1103410857 12:120710544-120710566 AAGGAGGAGAAGAAGAAGGCGGG + Exonic
1103592977 12:122005435-122005457 AAGGAGATGCTGAAGCCGGATGG - Intergenic
1103932383 12:124457588-124457610 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1104143387 12:126009370-126009392 AACCAGGAGCTGAAGCAGGAGGG + Intergenic
1104316190 12:127704214-127704236 AAGAAGCAGAAGAAACAAGAAGG + Intergenic
1104428372 12:128696364-128696386 AAGGAGAATCAGAGGTAGGATGG - Intronic
1104893504 12:132151220-132151242 AAGGAGCAGCGGATGGAGCAGGG - Intronic
1105028605 12:132867086-132867108 AAGGAGCCTCTGAAGAAGGAAGG + Intronic
1105040923 12:132960583-132960605 AAAGAGATGCAGAAGCAGAAGGG - Intergenic
1105762717 13:23528727-23528749 AAATACCAGAAGAAGCAGGATGG + Intergenic
1105828345 13:24142705-24142727 AAGGAGGAGAAGAAGAAGGGAGG - Intronic
1105896337 13:24719653-24719675 AAGAAGCAGAAGGAGGAGGAGGG + Intergenic
1106042063 13:26103094-26103116 GAGGGCAAGCAGAAGCAGGATGG + Intergenic
1106068482 13:26382087-26382109 AAGGAAGAGCAGAAGGAGTAAGG - Intronic
1106070003 13:26401466-26401488 AAGAACCAGCAGCAGCAGCAGGG + Exonic
1106112979 13:26793064-26793086 AGGAAACAGCAGAAGCAGGAGGG + Intergenic
1106205264 13:27587297-27587319 AAAGGGCAGCAGGAGCAGAAGGG - Intronic
1106255613 13:28019772-28019794 AGGGAGGACCAGAAGCGGGAGGG - Intronic
1106682384 13:32021696-32021718 AAGGGGTAGCAGAAGCATAAGGG - Intergenic
1106899248 13:34337646-34337668 AAAGAGCAGGAGAAAGAGGAGGG + Intergenic
1106926098 13:34614787-34614809 AAGGTGGGGCAGAAGAAGGAAGG - Intergenic
1106995557 13:35476295-35476317 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1107084230 13:36408187-36408209 AAGGAGGAGAAGGAGAAGGAGGG + Intergenic
1107473538 13:40713148-40713170 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1107795466 13:44046933-44046955 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1107826439 13:44332727-44332749 AGGCAGCAGCAGCAGCAGGGAGG - Intergenic
1108639705 13:52371706-52371728 TAACAGCAGCAGCAGCAGGATGG + Intergenic
1108695063 13:52895916-52895938 AAGGAGGAGCAGAAGCTGGCTGG - Intergenic
1108809287 13:54201503-54201525 AAGGAACAGCAGCAAGAGGATGG - Intergenic
1108850197 13:54718706-54718728 GAGGACGAGCAGAAGCAGGGTGG - Intergenic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1109219261 13:59624995-59625017 AGAAAACAGCAGAAGCAGGAAGG - Intergenic
1109256377 13:60088440-60088462 AAGGAGCAGCAGATTCTTGAAGG - Intronic
1109596893 13:64568350-64568372 AATGAACAGCAGAAGCAAGCAGG - Intergenic
1109672346 13:65625868-65625890 AAGGAGAAGGAGAAGCAACAAGG + Intergenic
1109918508 13:69023817-69023839 AAGAAGTAGTAGAAACAGGAAGG - Intergenic
1110156260 13:72320522-72320544 AGAAAACAGCAGAAGCAGGAAGG - Intergenic
1110601117 13:77375192-77375214 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
1110628227 13:77675958-77675980 CAGAAGCAGCAGAAGCAGTAAGG + Intergenic
1110945568 13:81411369-81411391 AAGGAGAAGGAGAAGAACGAGGG - Intergenic
1110968689 13:81733369-81733391 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1111316762 13:86572332-86572354 ACGGTTCAGCAGAAACAGGAAGG - Intergenic
1111954497 13:94741801-94741823 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1112460746 13:99601762-99601784 GAAAAACAGCAGAAGCAGGAAGG + Intergenic
1112488647 13:99842375-99842397 AGAAAACAGCAGAAGCAGGAAGG - Intronic
1112504908 13:99969780-99969802 CAGCAGCAGCTGGAGCAGGAAGG - Intronic
1113110175 13:106814287-106814309 AAGGAGCAGGAGAAGGGGAAGGG + Intergenic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113325398 13:109276746-109276768 AGGAGACAGCAGAAGCAGGAAGG + Intergenic
1113526412 13:110981421-110981443 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
1113556594 13:111240534-111240556 AAGGAGGAGGAGGAGGAGGAAGG - Intronic
1113909786 13:113836497-113836519 GAGGAGGAGGAGAAGCAGGGAGG + Intronic
1114254401 14:20989316-20989338 ACGTAGCAGCAGACACAGGAGGG + Intergenic
1114695561 14:24624010-24624032 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1114744901 14:25136567-25136589 AAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1114976121 14:28102143-28102165 CACCAGCTGCAGAAGCAGGATGG - Intergenic
1114994317 14:28328737-28328759 AAGGAGGAGGTGAAGCAAGATGG - Intergenic
1115018535 14:28646398-28646420 AAGGAGGAGGAGGAGAAGGAGGG + Intergenic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115175604 14:30558768-30558790 AAACAGCAGCAGCAGCAAGAAGG - Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1116233925 14:42253634-42253656 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1116658225 14:47675992-47676014 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1116773260 14:49151399-49151421 AAGCAGCTGGAGAAGGAGGAAGG - Intergenic
1117033700 14:51704629-51704651 AGGGAGGAGCAGAAACAGAAGGG + Intronic
1117097789 14:52315150-52315172 AATGAGAAGCAGCAGCAGGGTGG - Exonic
1117104184 14:52381982-52382004 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1117187092 14:53251020-53251042 GAGGAGCAGGAGGAGAAGGAGGG - Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117506725 14:56411757-56411779 AAGGAGAAGAAGAAGAAGAACGG + Intergenic
1117756674 14:58981617-58981639 AAGGAGCAGAAGAATCAAGGGGG - Intergenic
1117761636 14:59035328-59035350 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1118375320 14:65171777-65171799 AAGAAGAAGAAGAAGCTGGAAGG + Intergenic
1118459552 14:65976033-65976055 GAGGAGGAGGAGAAGAAGGAGGG + Intronic
1118641112 14:67793478-67793500 CAGAAGAAGCAGAAGCAAGAGGG - Intronic
1118647745 14:67856149-67856171 AAAGAGCAGAAAAAGCAGGAGGG - Intronic
1118705818 14:68479352-68479374 AAAAAACAGCAGAGGCAGGAAGG + Intronic
1118758502 14:68863226-68863248 AAGGGACAGCAGAAGCAACAAGG - Intergenic
1118973736 14:70659524-70659546 AAGCAGCCGCAGCAGGAGGAGGG + Intronic
1119181015 14:72605283-72605305 AGGGAGCAGGAGCAGGAGGAGGG + Intergenic
1119264414 14:73255556-73255578 AAGGAGCCTCACAAGCATGAGGG + Intronic
1119395168 14:74320924-74320946 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
1119618567 14:76114493-76114515 CAGCAGCAGCAGAAGCAGCATGG + Intergenic
1119719694 14:76882706-76882728 CAGGGGAAGCAGAAGCAGGCAGG - Intergenic
1119767686 14:77200628-77200650 CAGGGGCAGCAGAGCCAGGATGG - Intronic
1119895984 14:78220392-78220414 AAGCAGCAGATGCAGCAGGAAGG + Intergenic
1119907171 14:78316431-78316453 AGGGAGCTGGAGATGCAGGAAGG + Intronic
1120388129 14:83871237-83871259 AAGGGGGAGAAGAAGGAGGAAGG + Intergenic
1120624964 14:86813768-86813790 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1120880811 14:89413979-89414001 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1121195847 14:92071009-92071031 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1121734944 14:96211666-96211688 AAGGAGGAGCGGGAGGAGGAGGG - Intronic
1121735729 14:96216749-96216771 AAGGAGGAGGAGGAGGAGGAAGG + Intronic
1121802918 14:96790119-96790141 AAGGATGAGCAGAAGGAGTAGGG + Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1121978124 14:98425094-98425116 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1122244097 14:100389426-100389448 AAGAAACAGCAGAAGCTAGAAGG - Intronic
1122500421 14:102194464-102194486 AAGCAGCAGCAGCAGCATGTGGG - Intronic
1122608774 14:102966746-102966768 AAGCGGCTGCAGAAGCAGCAGGG - Intronic
1122691329 14:103533317-103533339 AAGGAGCAGCTCAGGCAGCAGGG + Intronic
1122773855 14:104108652-104108674 AAGGAGGAGCAGAGGCACAAAGG - Intronic
1123107907 14:105851533-105851555 AAGGGGCCGCAGAAGCAGGTGGG - Intergenic
1124145232 15:27118953-27118975 AGGGAACAACAGAAGCAGAAAGG + Intronic
1124370515 15:29102331-29102353 AAGGAGCAGCAGGGCCAAGAGGG + Intronic
1124417878 15:29489192-29489214 AGGCAGTAGCAGAAGCAGCATGG + Intronic
1124559334 15:30757450-30757472 AATGAGCAACTGAAGCAAGAAGG - Intronic
1124598430 15:31110921-31110943 GAGGAGCAGAAAAAGCAGAAGGG - Intronic
1124671919 15:31648271-31648293 AATGAGCAACTGAAGCAAGAAGG + Intronic
1124929124 15:34101789-34101811 TAGCAGCAGCAGCAGCAGGACGG + Exonic
1124957876 15:34371263-34371285 AAGGAGGAGGAGAAGGAGGTGGG - Intergenic
1125058800 15:35393731-35393753 AGAAAACAGCAGAAGCAGGAAGG - Intronic
1125158246 15:36614213-36614235 AGGGAGGAGCAGCAGCAGGGTGG - Intronic
1125333722 15:38606883-38606905 AGGAAGCCGCAGAAGCAGAAAGG - Intergenic
1125490807 15:40147209-40147231 AAGGAGCAGAACCAGAAGGAAGG + Intergenic
1125845728 15:42851333-42851355 AAAAAGCAGAAGAAGCAGGCAGG + Intronic
1125891958 15:43273705-43273727 AAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1125933958 15:43618681-43618703 CAGCAGCAGCAGCAGCAGCAGGG + Exonic
1125947055 15:43718143-43718165 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1126432128 15:48597557-48597579 AAGAGGAAGCAGAAGTAGGAGGG - Intronic
1126670827 15:51113686-51113708 ATGGGTCAGAAGAAGCAGGAAGG - Intergenic
1126852281 15:52804696-52804718 ATGGAGCCGAAGAAGCTGGAGGG - Intergenic
1127215501 15:56819395-56819417 AAGCAGCAGCAGGAGCAACAGGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128338426 15:66803213-66803235 AAAAAGCAGCAGCAGCAGGAAGG + Intergenic
1128554746 15:68623696-68623718 CAGGAGCAGCAGCAGCGGGTGGG + Intronic
1128560943 15:68667308-68667330 AAGCAGAGGAAGAAGCAGGATGG - Intronic
1128622279 15:69160810-69160832 ACGGAGCAGCCGGAGCAGGCGGG + Intronic
1128869821 15:71145864-71145886 GAGGAGGAGCAGGAGGAGGAGGG + Intronic
1128904005 15:71451480-71451502 GGGGAGCAGCAGATGCAGGCAGG - Intronic
1129325648 15:74798989-74799011 AAGGAGCATCAGGAGCAAGCAGG + Intronic
1129376036 15:75132585-75132607 AATGTCCAGCAGCAGCAGGATGG + Intergenic
1129600356 15:76995015-76995037 AAGCAGAGGCAGGAGCAGGATGG + Intronic
1129919913 15:79311278-79311300 GAGCAGCAGCAGAAGCAGCACGG - Exonic
1130312482 15:82767451-82767473 GAGGAGCTGGAGAGGCAGGAAGG + Intronic
1130721103 15:86386264-86386286 AAGGAGGAGGAGGAGGAGGAGGG - Intronic
1130721603 15:86391718-86391740 AAAGGGCTGCAGAAGCAGGCAGG + Intronic
1130825577 15:87542058-87542080 AAGGAGGAGGAGGAGAAGGAGGG - Intergenic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1130959867 15:88652484-88652506 AAGGAGGAGGGGAAGGAGGAGGG - Intronic
1130959872 15:88652496-88652518 AAGGAGGAGGGGAAGGAGGAGGG - Intronic
1131014180 15:89043625-89043647 AAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1131014192 15:89043665-89043687 AGGGAGGAGGAGAAGGAGGAGGG + Intergenic
1131284840 15:91048191-91048213 AAGAAGAAGAAGAAGAAGGAGGG - Intergenic
1131303243 15:91218435-91218457 AGAAAACAGCAGAAGCAGGAGGG - Intronic
1131430162 15:92380888-92380910 AAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1131614673 15:94003938-94003960 AGGGGGCAGCAGAAGGAGAATGG - Intergenic
1131877470 15:96825803-96825825 AAGCAGCAGCAGAAGCAGGATGG - Intergenic
1131976447 15:97950969-97950991 AAGGAACAGAGGAAGCTGGAAGG + Intergenic
1132219559 15:100095142-100095164 AAGGAGAGGCAGGAGCAGGTTGG - Intronic
1132399460 15:101496556-101496578 AAGGGGCGGCAGGGGCAGGAAGG - Intronic
1132549152 16:547232-547254 GAGGAGCAGGAGGAGGAGGAGGG + Exonic
1132571026 16:644043-644065 AAGAAGGTGCAGGAGCAGGATGG - Intronic
1132590871 16:725961-725983 AAGGAGCAGCAGCTGCAGGTGGG - Exonic
1132790614 16:1684947-1684969 AAAGAGCAGCAGAAGTAGTCTGG + Intronic
1132992679 16:2805089-2805111 AAGGAGCAGCAACAGCTGGGAGG - Intergenic
1132999455 16:2841690-2841712 CCACAGCAGCAGAAGCAGGATGG + Intergenic
1133050752 16:3115959-3115981 CAGAACCAGCAGATGCAGGAAGG - Intronic
1133194424 16:4158832-4158854 AAGGAGGAGAAGAAAGAGGAAGG + Intergenic
1133253075 16:4497406-4497428 AAGCAGCACCAGGAGCGGGAGGG - Intronic
1133303317 16:4795951-4795973 CAGCAGCAGCAGGAGCAGCACGG - Exonic
1133404767 16:5514720-5514742 GAGGAGCAGGAGGAGGAGGAGGG + Intergenic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1133867068 16:9654255-9654277 AAGGAGAAGGAGAGGAAGGAAGG + Intergenic
1134065334 16:11224746-11224768 AAGGAGCAGGGGAAGGAGGCGGG - Intergenic
1134762321 16:16725155-16725177 AAGCAACAGCAGCAGCAGGATGG + Intergenic
1134983738 16:18634015-18634037 AAGCAACAGCAGCAGCAGGATGG - Intergenic
1134997410 16:18750660-18750682 AAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1135138854 16:19904816-19904838 AGAAAACAGCAGAAGCAGGAAGG - Intergenic
1135148306 16:19982979-19983001 AGAAAACAGCAGAAGCAGGAAGG - Intergenic
1135295730 16:21278009-21278031 AAGGAGGAGCAGGAAGAGGAGGG - Intronic
1135427635 16:22352841-22352863 AAGGACCAGAAGAAGCTGGTGGG - Intronic
1135913147 16:26579214-26579236 AAGGAGGAGAAGAAGAAGGAAGG - Intergenic
1135920307 16:26643460-26643482 AAAGAGCAGCAGAGGGTGGAGGG - Intergenic
1135937521 16:26793668-26793690 AAGGAGCAGAAGAGGGAGGGAGG - Intergenic
1135942448 16:26834304-26834326 GAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1136030778 16:27501306-27501328 ATGGATCAGGAGAAGCAGGAAGG - Exonic
1136270556 16:29145967-29145989 CAGACGCTGCAGAAGCAGGAAGG + Intergenic
1136394824 16:29987172-29987194 AAGCAGCAGCAGCAGCAGGAGGG - Exonic
1136539095 16:30918701-30918723 AAGGAGGAGAAGGAGGAGGAAGG - Intergenic
1137367356 16:47872339-47872361 AAGCAGAAGCAGAAGCAGAAGGG + Intergenic
1137386497 16:48047474-48047496 AAGGAGGAGAAGCAGGAGGAGGG + Intergenic
1137468227 16:48730584-48730606 AAAGAGCAGCAGAAAGAGGGCGG - Intergenic
1137557141 16:49477641-49477663 AAGAAGAAGGAGAAGAAGGAGGG + Intergenic
1137655305 16:50153771-50153793 CAGCAGCAGCAGCAGCAGCACGG + Exonic
1137694581 16:50453018-50453040 GAGAAGCAGCAGAAGAAGAAAGG + Intergenic
1137767725 16:50991059-50991081 AAGGAACAGGAGAAGAAGGAAGG + Intergenic
1137938221 16:52656063-52656085 AGGGAGGAGCAGCAGCAGGGTGG - Intergenic
1138126174 16:54440503-54440525 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1138289596 16:55835595-55835617 AAGGAGAAGAAGGAGAAGGAGGG + Intergenic
1138370648 16:56523986-56524008 GATAAGCAGCAGAACCAGGATGG + Intergenic
1138395351 16:56700030-56700052 AAGGAGGAGGAGGAGGAGGAGGG - Intronic
1138461587 16:57151546-57151568 GAGGAGCAGCAGAAACAGTGGGG + Intergenic
1138969574 16:62128685-62128707 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1139099189 16:63744640-63744662 TAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1139347963 16:66316642-66316664 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1139478644 16:67216045-67216067 AAAGAGCAGGAGAAGGAGGAAGG - Intronic
1139605162 16:68013062-68013084 AAGGAGAAGAAGAAGAAAGAAGG + Intronic
1139937239 16:70580115-70580137 AAGCAGCAGCAGAATCGGGGTGG - Intronic
1140732456 16:77869126-77869148 AATGAGTAGCAGAAGGGGGAAGG + Intronic
1140851162 16:78935932-78935954 AAGCAGCAGCAGCAGCAGCTAGG + Intronic
1140903546 16:79391914-79391936 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141263073 16:82471333-82471355 AAGGAGAAGGAGAAACAGAAGGG - Intergenic
1141302691 16:82832446-82832468 AAGGAGGATGAGAAGGAGGAAGG - Intronic
1141346195 16:83248276-83248298 AAGGAGAAACAGAGGCAGGGGGG + Intronic
1142074144 16:88107778-88107800 CAGACGCTGCAGAAGCAGGAAGG + Intronic
1142160083 16:88552829-88552851 CAGGAGCTGGAGAGGCAGGAAGG + Intergenic
1142169147 16:88611481-88611503 AAGGAGCGGGAGAAGGAGAAGGG + Exonic
1142338963 16:89508422-89508444 ACGGAGCAGCAGCAGCAGCACGG - Exonic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1142707537 17:1705904-1705926 AAAACGCAGCAGAAGCAGCAGGG + Exonic
1142766412 17:2066942-2066964 AAAGAGCACCAGAAACAAGAAGG + Intronic
1142879519 17:2873510-2873532 AAGCAGCAGCAGCTGCAGAAAGG + Intronic
1143048262 17:4100453-4100475 AAGGAGGGGAAAAAGCAGGAAGG + Intronic
1143287325 17:5800063-5800085 AAGGTGGAGGAGAAGGAGGAAGG - Intronic
1143361127 17:6372186-6372208 GAGGAGAAGAAGCAGCAGGAGGG + Intergenic
1143391418 17:6561243-6561265 AAGGAAGAGGAGAAGGAGGAAGG - Intergenic
1143410849 17:6707504-6707526 AAGGAGGAGAAGGAGGAGGAGGG + Intronic
1143427225 17:6849497-6849519 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1143870279 17:9953310-9953332 AAGGAGTGGCAGAAGCAGCAGGG - Intronic
1144022751 17:11251678-11251700 AGGGAACAGCAGAAGCAAGCTGG - Intronic
1144035034 17:11357217-11357239 AAGAAGAAGAAGAAGCAGGGAGG + Intronic
1144235673 17:13258100-13258122 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144235679 17:13258127-13258149 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144408051 17:14971987-14972009 AGAAAACAGCAGAAGCAGGAAGG - Intergenic
1144562202 17:16330038-16330060 CAGAAGGAGCAAAAGCAGGAAGG + Intronic
1144838506 17:18171260-18171282 AAGGAGAAGCAAAAGCCGGAGGG - Intronic
1145274766 17:21422868-21422890 GGGGAGCAGCCCAAGCAGGAAGG + Intergenic
1145979261 17:29002231-29002253 AAGGAGCACAGGAAGCTGGAGGG + Intronic
1146174984 17:30660175-30660197 AAGGAGCAAGAGAAAGAGGAGGG - Intergenic
1146354880 17:32125538-32125560 CAGGTGCTGCAGAAGCAGCAGGG - Intergenic
1147000306 17:37358046-37358068 AAGTAGAAACAGAATCAGGAAGG + Intronic
1147267587 17:39244268-39244290 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1147327358 17:39675878-39675900 CAAGAGGAGCAGAAGCAGCAAGG - Intronic
1147498720 17:40942204-40942226 AAGGAGAAGAAGGAGAAGGAGGG - Intergenic
1147656754 17:42095490-42095512 ATGGGGCCGCAGCAGCAGGAGGG - Intergenic
1147663485 17:42130087-42130109 AAGAAGGGGCAGAAACAGGATGG + Intronic
1147681328 17:42248842-42248864 TACTAGCTGCAGAAGCAGGAGGG - Intronic
1148547351 17:48528501-48528523 ATGGAGAAACAGAAGCAGGCAGG + Intergenic
1148821946 17:50364945-50364967 CAGCAGCAGCAGCAGCAGGATGG - Intergenic
1149114164 17:53071726-53071748 AAGGAGAAGAAGAAAAAGGAGGG + Intergenic
1149865476 17:60149005-60149027 GAGGACCTGCAGTAGCAGGAGGG + Intergenic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150466829 17:65400698-65400720 AAGGAGAAACAAAAGAAGGAAGG - Intergenic
1150484123 17:65532421-65532443 AAGCAGCAGCAGCAGCAGCCAGG + Intronic
1150576339 17:66434025-66434047 CAGGAGCAGCAGAGCCAGGATGG + Intronic
1150596565 17:66610888-66610910 AGGGTGCAGCAAGAGCAGGAAGG + Intronic
1150628600 17:66859822-66859844 AAGGGGGAGGAGAAGGAGGAGGG - Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1150884543 17:69070438-69070460 GAGGGGGAGCAGAAGCAGGGTGG + Intergenic
1150964023 17:69947225-69947247 GAGGAGCAGGAGGAGGAGGAGGG - Intergenic
1151051084 17:70979213-70979235 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
1151441467 17:74132078-74132100 GAGGAGCAGCAGAAGCGGGAAGG - Intergenic
1151441884 17:74134883-74134905 AGGAAACAGCAGAAGCGGGAAGG - Intergenic
1151447430 17:74176428-74176450 AAGGAGGATGAGAGGCAGGAAGG + Intergenic
1151542644 17:74772547-74772569 ATGAAGGAGCAGAAACAGGAGGG + Intronic
1151562532 17:74878259-74878281 CTGGACCAGCAGCAGCAGGAGGG + Exonic
1151757229 17:76081894-76081916 GAAGAGCAGCAGCAGCAGGATGG - Exonic
1151960229 17:77401966-77401988 AAGGAGCAGCAGAGGAAGGCAGG - Intronic
1152055582 17:78023400-78023422 GAGGAGGAGCAGGAGAAGGAAGG - Intronic
1152068639 17:78124614-78124636 CACCAGCAGCAGCAGCAGGAGGG + Exonic
1152124550 17:78438425-78438447 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1152315955 17:79580279-79580301 AAGGAGGAGGAGGAGGAGGATGG - Intergenic
1152415828 17:80161167-80161189 GAGGAGCAGCAGCAGCAGCAGGG + Intergenic
1152509440 17:80775504-80775526 AAAGTGCAGCAGAAGCAAGGAGG + Intronic
1152651377 17:81495056-81495078 GAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1152698271 17:81806877-81806899 AAGGGGCAGCTGGAGCAGGGTGG - Intronic
1153359879 18:4182231-4182253 AAGAACAAGCAGAAGCAGGAAGG + Intronic
1153414021 18:4825461-4825483 AAGCAGCAGCAGCAGGAAGAGGG - Intergenic
1153680639 18:7497346-7497368 AAGGAAGAGGAGAAGGAGGAAGG + Intergenic
1154964957 18:21347397-21347419 AAGGAGCAGCAGAAGCAGGAAGG - Intronic
1155063228 18:22247039-22247061 AGGGAGGAGGAGGAGCAGGAGGG + Intergenic
1155161647 18:23201041-23201063 CAGGGAGAGCAGAAGCAGGAAGG + Intronic
1155231853 18:23781816-23781838 TAGAAGCAGCAGATGTAGGAAGG - Intronic
1155399198 18:25419704-25419726 CAGAAGCAGCAGGGGCAGGATGG - Intergenic
1155449819 18:25951827-25951849 AAGGAGTAGCAGAAGTGGGTAGG - Intergenic
1155499054 18:26469041-26469063 GAGGGGCAGCAGAAGCTGAAGGG - Intronic
1155610384 18:27660598-27660620 AGAAAGCAGTAGAAGCAGGAAGG - Intergenic
1155789958 18:29953087-29953109 AAGGAGCAGTTGAAGCAGGTGGG - Intergenic
1155857432 18:30850569-30850591 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1155865799 18:30963426-30963448 AGGAACCAGCAGAAGCAGGAAGG - Intergenic
1155896682 18:31337880-31337902 AAGGAGGAGCAGAAACAGGGGGG + Intronic
1155923565 18:31630013-31630035 GTGGAGAAGGAGAAGCAGGAAGG + Intronic
1155938115 18:31775423-31775445 AGGAAACAGCAGAAGCAAGATGG + Intergenic
1156078182 18:33305742-33305764 AAGGAGGAGAAGAAGGAGGAGGG - Intronic
1156149946 18:34228933-34228955 AGGGAGGAGCAGAAGCAAGTTGG + Intergenic
1156211181 18:34944758-34944780 AAGGAGCAAAAGAAGGAAGAAGG + Intergenic
1156281966 18:35648033-35648055 AAGAAGAAGAAGAAGAAGGAAGG + Intronic
1156315449 18:35965087-35965109 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1156406318 18:36786080-36786102 AAGGTGAAGCAGAGACAGGAAGG + Intronic
1156472287 18:37384792-37384814 AAGGAGCAGATAAAGCAGGAGGG - Intronic
1156596564 18:38554455-38554477 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
1156666814 18:39418594-39418616 AAGAAGCAGCAGCAGCAGCAAGG + Intergenic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1156791699 18:40983823-40983845 AAGGAGGTGGAGAAGGAGGAGGG - Intergenic
1156824812 18:41418343-41418365 AAATGGCAGAAGAAGCAGGAGGG + Intergenic
1157210081 18:45734780-45734802 GAGTAGCAGGAGGAGCAGGAGGG + Intronic
1157276069 18:46311896-46311918 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1157469129 18:47974670-47974692 CAGCAACAGCAGAAGCAAGAAGG + Intergenic
1157711359 18:49851987-49852009 AAGGAGGAGGAGGAGGAGGAGGG - Intronic
1157740963 18:50092431-50092453 ACGCAGCAGCAGCAGCAGGATGG - Intronic
1157786440 18:50487523-50487545 AGAAAACAGCAGAAGCAGGAAGG - Intergenic
1158197132 18:54900622-54900644 AGAAAACAGCAGAAGCAGGAAGG - Intergenic
1158248193 18:55455219-55455241 AAGGAGAAGTAGAAGAAGAAAGG + Intronic
1158453791 18:57589361-57589383 AAGGAGCACCCCAACCAGGAGGG + Intergenic
1158512997 18:58107918-58107940 CACGACCAGCAGAAGCAAGATGG - Intronic
1158578585 18:58661523-58661545 AAGCAGCAGCAGCAGCTGGTAGG + Intergenic
1158610685 18:58937578-58937600 AAAGAGCAAAAGAACCAGGAAGG - Intronic
1158862068 18:61602451-61602473 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
1158866484 18:61642722-61642744 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
1158870257 18:61679920-61679942 TACGAGCAACAGAAGGAGGATGG - Intergenic
1159921072 18:74227822-74227844 CAGCAGCAGCAGCAGCAGAAAGG + Intergenic
1160057656 18:75499541-75499563 AAGGAGTAGGAGAAGGAGAAGGG + Intergenic
1160187784 18:76688841-76688863 CAGGAGGAGCAGAAGCAGCCGGG + Intergenic
1160254226 18:77233865-77233887 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1160361873 18:78290202-78290224 ATGGAACACCAGCAGCAGGAGGG + Intergenic
1161009973 19:1955294-1955316 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1161370603 19:3908843-3908865 AAGGAGGAGAAGGAGGAGGAAGG - Intronic
1161431112 19:4233022-4233044 AAGGAGAGGCAGGAACAGGAGGG - Intronic
1161438646 19:4278777-4278799 TTGGAGCAGCAGAAGGAAGAGGG - Exonic
1161490505 19:4558401-4558423 TAGCAGCAGCAGAAGCAGCAGGG + Exonic
1161517985 19:4707355-4707377 AGGGAATGGCAGAAGCAGGATGG + Intronic
1161557799 19:4954413-4954435 GAGGAGGAGGAGCAGCAGGAGGG + Exonic
1161795054 19:6381562-6381584 AAGGCGCCGCAGCAGGAGGAGGG - Exonic
1161797256 19:6394172-6394194 AAGGAGCAGGAGAAGCACAGCGG + Intergenic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162076586 19:8191965-8191987 AAGGAGGAGGAGGAGAAGGAGGG + Intronic
1162876594 19:13625215-13625237 AAGAAGCAGCAGCAGCATCAAGG + Intergenic
1163463092 19:17450740-17450762 AAGGAGGAGGAGGAGAAGGAAGG - Intronic
1163609320 19:18292830-18292852 GAGGGGAAGCTGAAGCAGGAAGG - Intergenic
1163646083 19:18489873-18489895 AGGGGTCAGCAGAAACAGGAGGG - Intronic
1163690896 19:18737723-18737745 GAGGAGCAGCAGCAGGAGGGCGG - Intronic
1163690897 19:18737726-18737748 GAGGAGGAGCAGCAGCAGGAGGG - Intronic
1164435099 19:28222126-28222148 AAGGGGCAGTGGAAGCTGGAGGG - Intergenic
1164539965 19:29115065-29115087 AAGAAGCAGGAGAGGAAGGAAGG - Intergenic
1164776831 19:30859241-30859263 AAGGAGTAGCAGAAGTTGGATGG + Intergenic
1165059133 19:33196197-33196219 CAGCAGCAGCAGAGGCAGGAGGG - Intronic
1165159889 19:33809952-33809974 ATGGGGCAGGAGAGGCAGGATGG + Intronic
1165254669 19:34568511-34568533 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1165313027 19:35040038-35040060 AACAGGCAGCAGAAGCAGGGTGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166295421 19:41887148-41887170 ACGGAGCTACAGAAGCAGGAAGG + Intronic
1166297608 19:41896692-41896714 AAGGAGCAGAGGAAAAAGGAAGG - Intronic
1166502450 19:43352344-43352366 GAGGAGAAGCAGAAGAGGGAAGG - Intergenic
1167240928 19:48342560-48342582 GAAGAGCAGCAGCAGCAGGGAGG + Exonic
1167341992 19:48921854-48921876 CAGCAGCAGCAGCAGCAGCAAGG + Exonic
1167409487 19:49336663-49336685 GAGGAGGAGCTGAAGGAGGAAGG + Intronic
1167443681 19:49525045-49525067 CAGCAGCAGCAGCAGCAGGATGG - Intronic
1167625568 19:50586148-50586170 AAGGAGCAGCTGAACCCGGGAGG + Intergenic
1167648769 19:50718945-50718967 AAGGAGAAGCGGGAGCTGGAGGG + Intronic
1167774677 19:51547092-51547114 TAGCAGCAGAAAAAGCAGGAAGG - Intergenic
1168159443 19:54499603-54499625 AAGAAGAGTCAGAAGCAGGAAGG + Intronic
1168170582 19:54585765-54585787 AAGGGCGAGCTGAAGCAGGATGG - Intronic
1168213668 19:54909655-54909677 GAAGAACACCAGAAGCAGGAAGG + Intronic
1168687215 19:58356158-58356180 AACGAGCACCAGAAGCGGCACGG - Exonic
1168712892 19:58511911-58511933 GAGCAGCAGCAGCAGCAGCAAGG + Exonic
925020574 2:564711-564733 AAGGAGGTGCAGGAGGAGGAGGG - Intergenic
925132452 2:1503469-1503491 CAGGGGGAGCAGGAGCAGGAGGG + Intronic
925148612 2:1599801-1599823 AGGGAGCAGCAGGAAGAGGAGGG - Intergenic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925334173 2:3080748-3080770 GAGGAGCTGCAGAAGCAGCGTGG + Intergenic
925484581 2:4313653-4313675 TAGGGGGAGCAGAAGCAGGGTGG - Intergenic
925534336 2:4900501-4900523 CAGGGGCAGCAGAAGCTGGTGGG - Intergenic
926056008 2:9774430-9774452 AAGGAGCAGTTGGAGCAGGAAGG + Intergenic
926073303 2:9919006-9919028 AAGAAACAGCTGGAGCAGGACGG - Intronic
926115762 2:10212260-10212282 CAGCAGCAGCAGCAGCAGAAGGG - Intergenic
926231583 2:11008234-11008256 GAGCTGCAGCAGAAGGAGGAAGG - Intergenic
926451163 2:13005935-13005957 GAGGAGGAACAGAGGCAGGAAGG - Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926558302 2:14386558-14386580 CAGAAGGAGGAGAAGCAGGAGGG + Intergenic
926868042 2:17381196-17381218 AAGGAGCAGAGGAGGCATGATGG + Intergenic
926989195 2:18658899-18658921 AAGGATGAGGAGAAGGAGGAGGG + Intergenic
927097316 2:19757447-19757469 AAGAAGCAGGAGAAGGAAGATGG + Intergenic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
927339830 2:21970585-21970607 CAGAAGCAGCAGAAAAAGGATGG + Intergenic
927612661 2:24557491-24557513 GAGGAGGAGCAGGAGGAGGAGGG - Intronic
928278819 2:29926072-29926094 CAGGAGCAGCAGCAGCAAGCAGG + Intergenic
928533794 2:32219399-32219421 AGGGGGCAGAAGAAGGAGGAGGG - Intronic
928620203 2:33081275-33081297 AAAAAACAGCAGAAGCAGGAAGG - Intronic
928805058 2:35140533-35140555 AAGAAGCTGCAGTAGGAGGAGGG + Intergenic
928865616 2:35914307-35914329 CAGCAGCAGCAGTAGCAAGAGGG - Intergenic
929316485 2:40485122-40485144 GAGGAGGAGTAGAAGCAGGCAGG + Intronic
929333625 2:40713249-40713271 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
929508772 2:42550496-42550518 ATGGAGCAGCAGAAGGAAGGAGG + Intronic
929524967 2:42693461-42693483 AAGGGGAAGGAAAAGCAGGAAGG - Intronic
929590563 2:43143064-43143086 AGGCAGCAGCAGCAGCAGGAGGG - Intergenic
929604195 2:43224599-43224621 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
929863755 2:45700481-45700503 AAGGAACAGTAGAAGCAGCCCGG + Intronic
930089241 2:47519901-47519923 GAGGAGGAGGAGAAGCTGGAGGG + Exonic
930096428 2:47570252-47570274 CAGCAGCAGCAGCAGCAGGAGGG + Exonic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
930510254 2:52335492-52335514 AAGAAGGAGCAGAAGCAGGAAGG - Intergenic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931243273 2:60471384-60471406 AAGAAGCAGCAGAATCAGCTGGG - Intronic
931266192 2:60662316-60662338 AGAGAGCAGTGGAAGCAGGAAGG - Intergenic
931909895 2:66887820-66887842 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
931992699 2:67807074-67807096 AAACAGCAGCAGAAGCCTGATGG - Intergenic
932086267 2:68765063-68765085 AAAGGGCAGCAGAAACCGGAGGG - Intronic
932402223 2:71488958-71488980 GAGGAGCAGCTGAAGGAGGAAGG - Intronic
932610015 2:73191944-73191966 CAGGTGCAGGGGAAGCAGGAGGG + Intergenic
932740879 2:74290301-74290323 AGGCAGCAGCGGAAGCAGGCTGG - Intronic
933071084 2:77858422-77858444 AAGGTGGAGGAGAAGCAGGCAGG - Intergenic
933196043 2:79391270-79391292 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
933217625 2:79648520-79648542 AAGTAGCAGGACATGCAGGATGG + Intronic
933336321 2:80964195-80964217 TAGCAGCAGCAGCAGCAGCATGG + Intergenic
933502874 2:83138874-83138896 AAGGAGCAGGAGAAGGAGAAGGG + Intergenic
933513874 2:83276536-83276558 AAGGTGAAGGAGAAGCAAGAAGG + Intergenic
933690838 2:85178474-85178496 AAGGAGCTGGAGAAGGAGCAGGG + Intronic
933844282 2:86312983-86313005 AAAAAGCAGAAGAAGAAGGATGG - Intronic
934616094 2:95772192-95772214 GAAGAGAAGCAGAGGCAGGAGGG - Intergenic
934644802 2:96052368-96052390 GAAGAGAAGCAGAGGCAGGAGGG + Intergenic
934646831 2:96063806-96063828 AAGGAGCACCGGAAGCAAGCAGG - Intergenic
934653104 2:96103550-96103572 TATGAGGAGCAGCAGCAGGAGGG - Intergenic
934709732 2:96507047-96507069 AGAAAACAGCAGAAGCAGGAAGG + Intronic
934838213 2:97608457-97608479 GAAGAGAAGCAGAGGCAGGAGGG + Intergenic
934840231 2:97619888-97619910 AAGGAGCACCGGAAGCAAGCAGG - Intergenic
934850707 2:97699119-97699141 AAGGAGCAGCTAAACCAGGTGGG + Intergenic
934884412 2:98012046-98012068 AAGAAGTAGAAGGAGCAGGAAGG + Intergenic
935220504 2:101008294-101008316 AGGTAGCAGCAGAACCAGGGTGG + Intronic
935335815 2:102015219-102015241 AAGGAGCTCCAGAACCTGGAAGG + Intronic
935346900 2:102116707-102116729 AAACAGCAACAGCAGCAGGAAGG + Intronic
935465160 2:103388289-103388311 AATGAGCTGGAGAAGCAGGCAGG - Intergenic
935625527 2:105169350-105169372 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
935944545 2:108273563-108273585 AAGGAGCAGCAGCACGAAGAGGG - Intergenic
936097448 2:109541838-109541860 ATGGAGCAGCCGGAGCAGGCTGG - Intergenic
936247674 2:110842800-110842822 AGAAAACAGCAGAAGCAGGAAGG - Intronic
936495554 2:113017494-113017516 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
936598128 2:113868896-113868918 CAGCAGCAGCAGCAGAAGGAAGG + Intergenic
936657520 2:114505513-114505535 GAGGAACAGCAGATGCAGGAAGG - Intronic
936832835 2:116669860-116669882 AAGGAGAAGGAGAAGAGGGAAGG - Intergenic
936870701 2:117131948-117131970 AAGGAGCAGCCTAAGAAGGAGGG - Intergenic
936906006 2:117536398-117536420 AAGCAGGAGCAGCAGCAGCAAGG + Intergenic
937016101 2:118607477-118607499 GAGGAGCAGCAATAGCATGATGG - Intergenic
937130908 2:119512340-119512362 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937364192 2:121249023-121249045 ACGGAGCACCAGCAGCTGGAGGG - Exonic
937490257 2:122359548-122359570 AAGGAGGAGGAGTAGGAGGATGG - Intergenic
937878821 2:126849933-126849955 AAGGAGGAGGAGGAGCAGGAAGG + Intergenic
937920040 2:127122402-127122424 AGGGAGGAGCAGAAATAGGAGGG - Intergenic
937969413 2:127537723-127537745 AAGGAGGAGGAGGAGAAGGAAGG + Intronic
938043430 2:128095425-128095447 AAGGAGGAAGAGAAGGAGGAGGG - Intronic
938091061 2:128435097-128435119 AGGAAGCAGCAGAAGCAGGAAGG + Intergenic
938260397 2:129891752-129891774 CAGCAGCAGCAGGAGGAGGATGG - Intergenic
938488244 2:131738612-131738634 AAGGAGCAGGAAGAGCAAGATGG + Intronic
938736611 2:134191731-134191753 AAGGAGGAGGAGGAGGAGGAGGG - Intronic
938780653 2:134581814-134581836 AAGAAGCAGCAGAACCAAAAAGG + Intronic
939054835 2:137352160-137352182 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
939283419 2:140095686-140095708 AAGAAGCTGCATAAGAAGGAAGG - Intergenic
939316412 2:140556154-140556176 AGAAAACAGCAGAAGCAGGAAGG + Intronic
939335407 2:140820889-140820911 AAGAAGCAACAGAAAGAGGAGGG - Intronic
939861543 2:147426950-147426972 AAAGAGGAGTAGAAACAGGAAGG + Intergenic
940097408 2:149993294-149993316 AGGAAATAGCAGAAGCAGGAAGG - Intergenic
940235513 2:151507375-151507397 AAAAAACAGCAGAAGCAGGAGGG + Intronic
940879186 2:158929449-158929471 AAGGATGAGCAGGAGGAGGAAGG - Intergenic
941264140 2:163338524-163338546 CAGCAGCAGCAGCAGCAGTACGG + Intergenic
941465190 2:165817242-165817264 AAGAAGGAGGAGAAGAAGGAAGG + Intergenic
941638273 2:167960078-167960100 CAACAGCAGCAGATGCAGGAAGG + Intronic
941684768 2:168437120-168437142 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
942124394 2:172809152-172809174 GAGGGGCAGAGGAAGCAGGAAGG + Intronic
942305239 2:174600764-174600786 AAGCAACAGCAGAAACAAGATGG - Intronic
942607751 2:177710097-177710119 AAGGGACAGCAGATACAGGAGGG + Intronic
942898379 2:181085748-181085770 TAGGAGCAGCATAAGAAGGAAGG + Intergenic
942909577 2:181226960-181226982 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
943060950 2:183040775-183040797 AAGGAGGAGGAGAGGGAGGAGGG + Intergenic
943176724 2:184485243-184485265 AAGGAGCAGCATCAGCATTAGGG + Intergenic
943396714 2:187346839-187346861 AATCAGCAGCAGCAGCAGCAGGG + Intronic
943649814 2:190445090-190445112 AATAAGGAGCACAAGCAGGATGG - Intronic
944129865 2:196336087-196336109 AAGGAGTGGCAAAAGCAGGGAGG + Intronic
944455973 2:199894579-199894601 AAGGAGCAGCAGAGTCAAGGTGG - Intergenic
944456746 2:199902829-199902851 AGAAAACAGCAGAAGCAGGAAGG - Intergenic
944900344 2:204207560-204207582 AGGAAACAGCAGAAGTAGGAAGG - Intergenic
945000528 2:205345493-205345515 AGTAAACAGCAGAAGCAGGAAGG - Intronic
945502499 2:210593372-210593394 AAACAGCAGCAGGAGAAGGAGGG + Intronic
945521492 2:210833095-210833117 CAGTTGCAGCAGAAGCAGGTAGG + Intergenic
945684186 2:212949365-212949387 AAGGAATAGCAAGAGCAGGATGG - Intergenic
946192724 2:218016019-218016041 AAAGTGCAGGAGAAGGAGGAAGG + Intergenic
946219153 2:218211537-218211559 AAGGAGCCCCAGCAGGAGGAAGG - Intergenic
946276883 2:218638359-218638381 GGGGAGCGGCAGGAGCAGGAGGG + Exonic
946366133 2:219250217-219250239 ACAGAGCAGCAGCAGCATGAAGG + Exonic
946372713 2:219290422-219290444 GAGGAGGCGCAGAAGCAGGTGGG + Intronic
946469770 2:219947733-219947755 AATGTGCAGCAGAGGCATGAGGG - Intergenic
946536968 2:220641193-220641215 CAGAAACAGCAGAAGCAAGAAGG + Intergenic
946621334 2:221566935-221566957 AAGGAGAAGGAGAAGGAGAAGGG + Intronic
946919920 2:224568057-224568079 AAGGAGGACCAAAAGCAGGGGGG - Intronic
946977060 2:225164719-225164741 CAGCAGCAGCAGCAGCAGCAAGG - Intergenic
946996660 2:225400321-225400343 GAGGAGAAAGAGAAGCAGGAAGG + Intergenic
947047882 2:226008851-226008873 AAGGAAGAGCAGACGGAGGAGGG + Intergenic
947204580 2:227648553-227648575 AAGCAGCAGCAGCACCAGGTAGG + Intergenic
947295663 2:228627759-228627781 AAGGAGAAGAAGAAGAAGGAGGG - Intergenic
947364595 2:229381118-229381140 GAGGGCGAGCAGAAGCAGGATGG + Intronic
947488399 2:230573130-230573152 AGGGAGGAGCAGCAGCAGGGTGG + Intergenic
947549502 2:231036564-231036586 AAGACGCCGCAGAAGCAAGAGGG - Intergenic
947575764 2:231272981-231273003 AAGGTGCTGCAGATGCTGGAGGG + Exonic
947615661 2:231555273-231555295 AAGGAGCAGCGAGAGTAGGAGGG + Intergenic
948488304 2:238295259-238295281 AAGGAGAAGAAGAAGAAAGAAGG - Intergenic
948536374 2:238650506-238650528 AAGGCGTAGCAGGAGCAGAAGGG - Intergenic
948538992 2:238672320-238672342 AAGGAGGAGAAGAAGGAGAAGGG - Intergenic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
948992760 2:241563151-241563173 CGGGAGCAGCAGGAGCAGGGAGG - Intronic
1168771890 20:420871-420893 CGGAAGCAGCAGCAGCAGGAGGG + Exonic
1169984189 20:11423418-11423440 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1170532997 20:17313381-17313403 CAGGAGCAGCAGGAGTGGGAGGG - Intronic
1170579235 20:17685238-17685260 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1170624523 20:18021221-18021243 AGGCAGCAGCAGCAGCAGTAGGG - Intronic
1170673188 20:18454070-18454092 AGGGAGCAGCACATGCAGGCAGG + Intronic
1170940684 20:20845654-20845676 AAGGAGGAACAGAAGCAGAAAGG + Intergenic
1171093371 20:22307123-22307145 AAGGAACAGCAGCAGCAGCTTGG + Intergenic
1171151833 20:22834508-22834530 AAGGATAAGCAGAATCAGGATGG - Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1171941186 20:31331312-31331334 GAGGAGCAGGAGAAGGAGGAGGG + Intergenic
1172174505 20:32963986-32964008 AAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1173164475 20:40676995-40677017 TAGGAGTAGGAGAAGTAGGAGGG + Intergenic
1173344285 20:42184499-42184521 AAGGAGGAGGAGGAGGAGGAAGG - Intronic
1173381999 20:42553833-42553855 ACCAAGCAGCAGTAGCAGGATGG + Intronic
1173541337 20:43854034-43854056 CAGCAGCCGCAGATGCAGGACGG - Intergenic
1173560863 20:44004411-44004433 AAGGAGAAGGTGAAGCAGGAAGG + Intronic
1173848518 20:46203009-46203031 GAGGAGCAGCAGCAGCATGGAGG - Intronic
1173848519 20:46203012-46203034 GAGGAGGAGCAGCAGCAGCATGG - Intronic
1174068499 20:47883239-47883261 AAGGAGCAGCAGGTGCTGGGTGG + Intergenic
1174882166 20:54291869-54291891 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1174898565 20:54475573-54475595 AAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1175073396 20:56353622-56353644 GAGAAGCAGGAGCAGCAGGAGGG - Intergenic
1175269445 20:57723534-57723556 CAGGAGCTGCAGAGGCAGGTGGG + Intergenic
1175387464 20:58606350-58606372 AAGGAGCAGAAGACGGAGCATGG + Intergenic
1175423354 20:58849852-58849874 TAGGAAAAGCAGAAGCAGCATGG - Intronic
1175429383 20:58891271-58891293 AAGGAGGAGGAGGAGGAGGAGGG - Intronic
1175452084 20:59077886-59077908 AAGGAGAAGGAGAAAAAGGAGGG + Intergenic
1175501060 20:59451160-59451182 TAGAAGCAGCAGCAGCAGCAAGG - Intergenic
1175988756 20:62777206-62777228 AAGGAGGAGATGAGGCAGGAAGG + Intergenic
1175988760 20:62777225-62777247 AAGGAGGAGATGAGGCAGGAAGG + Intergenic
1175988767 20:62777260-62777282 AAGGAGGAGATGAGGCAGGAAGG + Intergenic
1176105628 20:63384522-63384544 AAGAAGCTGCAGCAGCTGGAGGG - Intergenic
1176720448 21:10388294-10388316 CAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1176918982 21:14663630-14663652 AAGGACCAGAAGGAGGAGGAAGG + Intergenic
1177237569 21:18412722-18412744 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1177643437 21:23872692-23872714 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
1178135264 21:29619774-29619796 AAGCAGCAACAGAAGCAGCATGG + Intronic
1178580166 21:33831592-33831614 TTGGAACAGCAGGAGCAGGAAGG + Intronic
1178848529 21:36193560-36193582 AGAAAACAGCAGAAGCAGGAAGG - Intronic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1179225793 21:39451903-39451925 AAGGAGCAGCAGAGGCATCTTGG - Exonic
1179238311 21:39566557-39566579 AGGGACAAGAAGAAGCAGGAGGG - Intronic
1179238548 21:39568387-39568409 AAGCAGCTGGAGAGGCAGGAGGG - Intronic
1180162482 21:46004388-46004410 AAGGAGCTGCGCAGGCAGGAGGG - Exonic
1180301652 22:11041143-11041165 CAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1180516705 22:16151160-16151182 AAGGACTTGCAGAACCAGGAAGG + Intergenic
1180628905 22:17213648-17213670 AATGAGGAGGAGAAGCAGCACGG + Intronic
1180863896 22:19104881-19104903 AAGCAGCAGCAGCAGCAGAGGGG + Intronic
1181408709 22:22703214-22703236 AAGGAAAGGCAGAGGCAGGAGGG - Intergenic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181493945 22:23277510-23277532 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1181517130 22:23421269-23421291 AAGGAGCCCCAGAAGCAGCATGG + Intergenic
1181615623 22:24052239-24052261 AGGGAGAAGTAGAAGCAAGAGGG + Intronic
1181720228 22:24768582-24768604 AAGGAAAACAAGAAGCAGGAAGG + Intronic
1181725995 22:24811308-24811330 AGGGCGCAGCAGGTGCAGGATGG - Intronic
1181766172 22:25093886-25093908 AAGCAGAAGCAGAAGCAGAAGGG - Intronic
1181977211 22:26738473-26738495 AAGGAGGAGAACAAGGAGGAGGG - Intergenic
1182099525 22:27648162-27648184 AAGAAGGAGAAGAAGGAGGAGGG + Intergenic
1182123130 22:27799612-27799634 CAGCAGCAGCAGCAGCAGCATGG - Exonic
1182126069 22:27816756-27816778 AAGGATCAGAAGAGGGAGGAGGG - Intergenic
1182440561 22:30361491-30361513 AAAAAACTGCAGAAGCAGGAAGG - Intronic
1182460747 22:30481882-30481904 CAGCAGCAGCAGGAGCAGGAGGG + Intergenic
1182651236 22:31852916-31852938 AAGAGGCAGCTGAAGCTGGATGG + Intronic
1182754582 22:32668516-32668538 AAGGAGAAGGAGAAGGAGAAAGG - Intronic
1182755876 22:32678530-32678552 AAGGAGGAGGAGGAGGAGGAAGG - Intronic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1183111770 22:35654825-35654847 AAGAAGCAGCAGATGCAGGAAGG + Intronic
1183273766 22:36878325-36878347 ACAGAGCAGCAGAGACAGGAAGG - Intergenic
1183445939 22:37854989-37855011 AAAGAGCCAGAGAAGCAGGAGGG + Intronic
1184226192 22:43130052-43130074 AAGGGGCACCAGGGGCAGGAGGG + Intergenic
1184295925 22:43525541-43525563 AAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1184379518 22:44136336-44136358 AAAGAGCAACAGGAGAAGGAGGG - Intronic
1184505604 22:44899629-44899651 GAGGAGGAGAAGAAGAAGGAAGG - Intronic
1184677194 22:46050177-46050199 ATGGGGCAGCAGCAGCAGGAGGG + Exonic
1184883819 22:47329815-47329837 GAAGAGGAGCAGAAGGAGGAAGG + Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185049128 22:48544523-48544545 AATGAGCTGCAGCACCAGGAGGG + Intronic
1185050445 22:48551455-48551477 GAGGAGCTGCATGAGCAGGATGG + Intronic
1185202289 22:49514946-49514968 AAGGAGTACCAGCAGCAGGCGGG + Intronic
1185301232 22:50082142-50082164 CGGGACCAGCTGAAGCAGGAGGG + Intronic
1185330243 22:50249115-50249137 TGGGAGCAGCAGGTGCAGGAAGG + Exonic
949102541 3:163459-163481 AAGGAGAAGAAGATGGAGGAGGG - Intergenic
949312324 3:2713648-2713670 AGCAAACAGCAGAAGCAGGAAGG - Intronic
949360914 3:3231291-3231313 AAGGTGAAGCAGAAGCTGGCAGG + Intergenic
949700271 3:6748673-6748695 AAGGAGGAGGAGAAGGAGAAGGG - Intergenic
949748236 3:7320599-7320621 AGGAAACAGAAGAAGCAGGAAGG - Intronic
949957927 3:9285357-9285379 AGAAAACAGCAGAAGCAGGAAGG + Intronic
950108304 3:10402293-10402315 AAGGAGAGGCAGAGGCAGGTTGG - Exonic
950143762 3:10633362-10633384 AAGGAGCGGCAAATCCAGGATGG - Intronic
950187986 3:10957235-10957257 CAGCAGATGCAGAAGCAGGAGGG + Intergenic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950575931 3:13832069-13832091 AAGCAGGAGCAGGAACAGGAGGG - Intronic
950703011 3:14762968-14762990 AAGGAGGAGCAGATGCTGAAAGG + Intronic
950808855 3:15632379-15632401 AGGGAACAGCAGAACCAGGAAGG - Intronic
951254582 3:20433409-20433431 GAGGACGAGCAGAAGCAGGGTGG - Intergenic
951676521 3:25247616-25247638 GAGGATGAGCAGAAGCAGGGTGG - Intronic
951771128 3:26258822-26258844 AAGGAGGACCAGTAGCAGAATGG + Intergenic
951811085 3:26700962-26700984 AAGGAACAGTAGAGGCAAGAAGG - Intronic
952046488 3:29327486-29327508 AAGGAGGAGGAAAAGGAGGAAGG - Intronic
952165651 3:30745961-30745983 GAGGAGGAGGAGGAGCAGGAGGG - Intronic
953563449 3:44012390-44012412 GAGGAGCAGCAGCAGTAGGCTGG - Intergenic
953704841 3:45223406-45223428 AAGGGGCAGCTGAAGCTGCAGGG + Intergenic
953847631 3:46440667-46440689 TAGAAGGAGCAGAAGCAGAAGGG + Intronic
954000135 3:47550011-47550033 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
954005619 3:47588211-47588233 AAGGAGCAGCTGAGGCTGGCGGG + Exonic
954439515 3:50514094-50514116 AAGGGGCAGGGGAGGCAGGAAGG - Intergenic
954955177 3:54512515-54512537 AAGGTGCAGGAGAAAAAGGAAGG - Intronic
955036348 3:55271821-55271843 AAGGAGGAAGGGAAGCAGGAAGG + Intergenic
955567356 3:60261725-60261747 AGGAAACAGCAGAAGCAAGAAGG + Intronic
955819557 3:62881715-62881737 CAGCAGAGGCAGAAGCAGGAAGG - Intergenic
956014520 3:64867525-64867547 AAAAAGCCGCAGAAGCAGGAAGG - Intergenic
956308865 3:67856934-67856956 ATGGACCAGCAGCAGCAGCATGG + Intergenic
956916882 3:73881039-73881061 AAGCAGCAGTAGAAACAGGAAGG + Intergenic
957011353 3:75009190-75009212 GAGGGCCAGCAGAAGCAGGGTGG - Intergenic
957134731 3:76271700-76271722 AAAGAGCCAGAGAAGCAGGAGGG - Intronic
957315806 3:78575200-78575222 AGGAAACAGCAGAAGTAGGAAGG - Intergenic
957553558 3:81736960-81736982 ATGGAGTAGTAGAAGCAGGAAGG + Intronic
957680415 3:83426330-83426352 AAGGAGCAGCAGAACCGACAAGG - Intergenic
957747757 3:84366595-84366617 GAGGGCCAGCAGAAGCAGGGTGG - Intergenic
957899945 3:86476258-86476280 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
958075835 3:88677033-88677055 GAGGAGGAGCAGAAAAAGGAAGG - Intergenic
958154594 3:89740352-89740374 AAGGAGGAGGAGGAGAAGGAGGG + Intergenic
958804956 3:98799408-98799430 AAGAAGTATCAGGAGCAGGAAGG - Exonic
959157495 3:102684644-102684666 AGAAAGCAGCAGAAGCAGAAAGG + Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959291086 3:104475133-104475155 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
959768705 3:110066902-110066924 AAGGAGCAGGAGAAAGAGGAAGG - Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960155577 3:114294381-114294403 AAGGAGCAGGAGAAGAAGAAGGG + Intronic
960190401 3:114697734-114697756 AAGGAGCAGGAGAGGGAGGGAGG + Intronic
960198912 3:114807436-114807458 AAGAAGCAGCAGCAGCTGCAGGG - Intronic
960224747 3:115156641-115156663 AAGAAGTAGAAGAGGCAGGAAGG - Intergenic
960723477 3:120647313-120647335 AAGGGGTAGCAGAAATAGGATGG + Intronic
960738499 3:120806392-120806414 AAGAAGCAGCAGAAACACAAGGG + Intergenic
960760163 3:121064267-121064289 GAGGAGGAGCAGAAGCAGGGTGG - Intronic
960845557 3:122001399-122001421 AATCAGCAGCAGGAGGAGGAGGG + Exonic
961035483 3:123638739-123638761 GAGGAGTAGGAGAGGCAGGAGGG - Intronic
961254871 3:125540892-125540914 AAGGAGCATGAGGAGGAGGAAGG + Intronic
961517399 3:127446512-127446534 AGGCTGCAGAAGAAGCAGGATGG + Intergenic
961612502 3:128152457-128152479 AAGGAGCAGGAGAGGGAGGATGG - Intronic
961835002 3:129650414-129650436 AAGCAGCAGCAGCAGCCAGAGGG + Exonic
961879406 3:130050281-130050303 AAGAAGAAGGAGAAGAAGGAAGG + Intergenic
961989025 3:131167820-131167842 AAGGAGCAAAGGGAGCAGGAGGG + Intronic
962137783 3:132755823-132755845 AAGAGGGACCAGAAGCAGGAAGG + Intergenic
962264507 3:133935480-133935502 AAGGGGCAGCAGCAGAAAGAAGG - Intronic
962391277 3:134974876-134974898 CAGGAGCAGCTCAAGCAGGAAGG - Intronic
962475703 3:135753233-135753255 CAAGAGCAGGAGAGGCAGGACGG + Intergenic
962594389 3:136925515-136925537 ACGGGGCAGCAGGAACAGGAGGG - Intronic
963049498 3:141128908-141128930 AAGGAGCCCTAGAAACAGGATGG - Intronic
963505150 3:146175728-146175750 TTGGAGCAACAGAAGTAGGAGGG - Intergenic
963809991 3:149766862-149766884 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
963988220 3:151622480-151622502 AAGGAGGAGAAGAAGAAAGATGG - Intergenic
964791057 3:160453352-160453374 AAGGAGCAGCTGCAGCGGCAGGG + Intronic
964886461 3:161489199-161489221 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
965199746 3:165642469-165642491 AAGAAGGAGCAGAGGCAAGAAGG - Intergenic
965439382 3:168694006-168694028 GAGGAGAAGTAGCAGCAGGAGGG + Intergenic
965511024 3:169568065-169568087 GAGGGTGAGCAGAAGCAGGATGG + Intronic
965980155 3:174680759-174680781 AAGGAGAAGGAGGAGCAAGATGG + Intronic
966041225 3:175490716-175490738 AAGTACCATCAGAAGCAGGATGG + Intronic
966319618 3:178686589-178686611 AGAGAACAGCAAAAGCAGGAAGG - Intronic
966448178 3:180027116-180027138 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
966521915 3:180882423-180882445 GAGGAGGAGGAGAAGGAGGAAGG - Intronic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966564433 3:181360760-181360782 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
966568160 3:181406738-181406760 AAGATGCGGCAGAAGAAGGAAGG + Intergenic
966816981 3:183897330-183897352 ATGGAGCAGCAGATGCTGGCTGG + Intergenic
966895104 3:184439078-184439100 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
966921872 3:184617473-184617495 CAGCAGCAGCAGCAGCAAGATGG + Intronic
967360492 3:188624749-188624771 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
967742730 3:193021123-193021145 AAAAAGCAGCAGCAGCAGCATGG - Intergenic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
968137244 3:196228227-196228249 CAGGGGCAGCAGCAGCAGCAGGG - Exonic
968276667 3:197445632-197445654 AAGGAGCAGAAGAAGGAACAGGG - Intergenic
968331008 3:197870173-197870195 TAGGTGCAGCAGATGGAGGAAGG - Exonic
968463693 4:738987-739009 AGGGAGCAGCAGGTGCAGCAAGG - Intronic
968565325 4:1309574-1309596 GAGGAGGAGCAGAGGCAGGGAGG + Intronic
968744765 4:2353903-2353925 ACGGGGCAGCAGAAGCTGGCTGG - Intronic
968914187 4:3490002-3490024 AATGAGCAGGAGGAGAAGGAAGG - Intronic
968914389 4:3490923-3490945 AATGAGCAGGGGAAGAAGGAAGG - Intronic
968914457 4:3491216-3491238 AAAGAGCAGCGGGAGAAGGAAGG - Intronic
969006136 4:4021336-4021358 CAGCAGCAGCAGCAGCTGGAGGG + Intergenic
969149238 4:5154633-5154655 TAGGAGCACCAGACACAGGAAGG - Intronic
969164902 4:5299092-5299114 AAGGGCAAGCAGAAGCAGGGTGG - Intronic
969197083 4:5571592-5571614 AAGGAGCAGCAAGAGGAGTAAGG + Intronic
969425202 4:7120247-7120269 AAGTAGCAGAAGTAGCAGGCAGG + Intergenic
969483886 4:7460976-7460998 AAGGAGCAGCACGAGGATGATGG - Intronic
969523933 4:7694665-7694687 AATGAACAGAAGAAGCAGCAGGG - Intronic
969560771 4:7946397-7946419 AAGCAGGAGCAGAAGGATGAGGG + Intergenic
969671547 4:8592841-8592863 AAGGAGCAGCAGCGGCAGCGGGG - Exonic
969689714 4:8697855-8697877 CAGGAGCAGGAGAAGCAGGAAGG - Intergenic
969806812 4:9615954-9615976 CAGCAGCAGCAGCAGCTGGAGGG - Intergenic
969823717 4:9740263-9740285 AAGCAGAAGGAGAAGAAGGAAGG - Intergenic
969954804 4:10877995-10878017 AAGGAGGAGGAAAAGGAGGAAGG - Intergenic
969979534 4:11140494-11140516 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
970001199 4:11367775-11367797 GAGGAGGAGAAGGAGCAGGAAGG - Intergenic
970044064 4:11830093-11830115 ATGGAGCAGAAGAAAAAGGAAGG + Intergenic
970099141 4:12501318-12501340 AAGGAAGAGGAGAAGAAGGAAGG + Intergenic
970099156 4:12501382-12501404 AAGGAGGAGGAGGAGGAGGAAGG + Intergenic
970180275 4:13384370-13384392 CAGCAGCAGCAGCAGCAGCACGG - Intronic
970253078 4:14137049-14137071 AAGGAGCTGCAGAAACAAGGAGG + Intergenic
970501222 4:16679294-16679316 AAGGAGGAGGAGAGGGAGGAAGG + Intronic
970525096 4:16924111-16924133 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
970531524 4:16990176-16990198 AGAGAACAGCAGAAGCAGGGAGG + Intergenic
970592562 4:17572212-17572234 CAGCAGCAGCAGCAGCAAGATGG - Intergenic
970943997 4:21668997-21669019 GAGGAGGAGGAGAAGCAGGCAGG - Intronic
971001951 4:22333150-22333172 AAGGTGAAGGAGAAGCAGGCAGG - Intergenic
971094682 4:23387374-23387396 AAGGAGAAGCAGAAGTAAGATGG - Intergenic
971342448 4:25782948-25782970 TGGGAGAAGCAGAAGCAGAAGGG + Intronic
971425638 4:26512452-26512474 AGGGAACAGGAGGAGCAGGAGGG + Intergenic
972260945 4:37407878-37407900 GAGGGCGAGCAGAAGCAGGATGG + Intronic
972363468 4:38350745-38350767 AAGGTGCATCAGGAGCAAGAGGG + Intergenic
973306689 4:48659986-48660008 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
973830284 4:54752502-54752524 CAGCAGCAGCTGAAGCAGGAGGG + Intergenic
974251862 4:59394798-59394820 GAGGGCCAGCAGAAGCAGGTTGG - Intergenic
974305582 4:60134549-60134571 ATGAAGCATCAGAAGCAGGCTGG - Intergenic
974359941 4:60864453-60864475 AAGAAGCAGCTGAACCAGAAGGG + Intergenic
974677223 4:65108426-65108448 AAAGAGAAGCAGAAGCACTATGG - Intergenic
974845403 4:67345712-67345734 AAGATAGAGCAGAAGCAGGAAGG - Intergenic
975028215 4:69578513-69578535 AAGGAGAAGAAGAAGAAAGAAGG - Intergenic
975110399 4:70617040-70617062 AAGAAGCAGAGGAACCAGGAAGG + Intergenic
975224967 4:71860553-71860575 AAGGAGCTGAAGCAGCAGGGTGG + Intergenic
975466418 4:74714252-74714274 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
976088181 4:81427732-81427754 AAGCAGCAGCAGCAGCAGGCAGG + Exonic
976126079 4:81835053-81835075 AAGGAGGAACAGAGGGAGGAAGG + Intronic
976208513 4:82644301-82644323 AAGAAGGGGCAGAAGCAAGATGG - Intronic
976362981 4:84202471-84202493 GAGGGCCAGCAGAAGCAGGATGG + Intergenic
976561929 4:86511711-86511733 GAGGAGGAGCGGGAGCAGGAGGG + Intronic
976695800 4:87918705-87918727 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
976756230 4:88500573-88500595 AAGGGGCAGGAGAACTAGGATGG + Intronic
977585776 4:98773912-98773934 AGGGAGGAGGAGAGGCAGGAGGG - Intergenic
977679465 4:99783280-99783302 GAAAAACAGCAGAAGCAGGAAGG + Intergenic
977701477 4:100027931-100027953 AATGAGTAGCAGAAGAAGGTAGG - Intergenic
978702307 4:111662589-111662611 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
979577427 4:122310708-122310730 GAGAAGCAGCAGATGCAGGAAGG - Intronic
979678065 4:123431163-123431185 AAGAAGCAGCAGCAGCAGCAGGG - Intergenic
980712476 4:136588803-136588825 GAGGAGGAACAGGAGCAGGAAGG + Intergenic
980833034 4:138154741-138154763 AAGAAGAAGAAGAAGAAGGATGG - Intergenic
981131502 4:141162651-141162673 GAGGACAAGCAGAAGCAGGGTGG + Intronic
981511963 4:145567024-145567046 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
981600360 4:146481400-146481422 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
981735206 4:147942581-147942603 AAGGGGCAGGAGAAGGAGGACGG - Intronic
981868468 4:149456788-149456810 AGAAAACAGCAGAAGCAGGAAGG - Intergenic
982139925 4:152307565-152307587 GAGGAGCTGGAGAAGCAGGGAGG + Intergenic
982196939 4:152925876-152925898 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
982560307 4:156921478-156921500 AAGGAGGAGGAGAAGGAGAAAGG + Intronic
983044602 4:162970167-162970189 GAGGGCCAGCAGAAGCAGGGTGG - Intergenic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
983271443 4:165567131-165567153 TAGGAACAGCATAACCAGGAAGG + Intergenic
983524709 4:168749178-168749200 AAGGTGAAGCAGGAGCAGGCAGG - Intronic
983690927 4:170468134-170468156 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
983698259 4:170559503-170559525 GAGGAGAAGCAGGAGCAGGCAGG - Intergenic
984078182 4:175209106-175209128 AAGAAACAGCAGATGCAGGAAGG - Intergenic
984183238 4:176510884-176510906 AAAGAGCTGGAAAAGCAGGATGG + Intergenic
984657163 4:182330523-182330545 AGAAAACAGCAGAAGCAGGAAGG - Intronic
984660398 4:182368234-182368256 CACGAGCATCAGAGGCAGGATGG + Intronic
984849848 4:184144035-184144057 AAGGTGCAGCAGAGGCTGGCAGG + Intronic
986211761 5:5680048-5680070 AGGCAGCATCAGAAGCATGAAGG - Intergenic
986221734 5:5774775-5774797 AAGTAGGAGGAGAAGGAGGAGGG - Intergenic
986221782 5:5774973-5774995 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
986387033 5:7244682-7244704 AAGGAGCACACGAAGCGGGATGG + Intergenic
986469357 5:8058900-8058922 GAGGGGCAGCAGAGGCAGCACGG + Intergenic
986561408 5:9063761-9063783 AGGCAGCAGCAGCAGCAGGTGGG + Intronic
986566769 5:9123467-9123489 AAGGAGAAGGAGAAGAATGATGG + Intronic
986777303 5:11028291-11028313 TAGCAGCTGCAGAAACAGGAGGG - Intronic
986879105 5:12147877-12147899 AAGGAGGAGGAGGAGGAGGATGG - Intergenic
986885259 5:12226200-12226222 AAGAAGCAGCAGTAGCCAGATGG - Intergenic
987025910 5:13926188-13926210 AAGGAGCACCTGAGGGAGGATGG + Intronic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987259596 5:16189946-16189968 AGAAAACAGCAGAAGCAGGAAGG - Intergenic
987566371 5:19593530-19593552 AGGGAGAAGGAGAAGAAGGAAGG - Intronic
988004045 5:25384836-25384858 AAGGAGCTCTAGAATCAGGAAGG - Intergenic
988211990 5:28215862-28215884 AAGGAGGAGAAGAAGGAGGTGGG - Intergenic
988255767 5:28818379-28818401 AAGGAGGAGGAGGAGAAGGAGGG + Intergenic
988435319 5:31167652-31167674 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
988496082 5:31747462-31747484 AAAAAACAGCAGAAGCAGGGAGG - Intronic
988671130 5:33383086-33383108 AAGAAACAGCAGAAACAAGAAGG + Intergenic
988970712 5:36465105-36465127 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
989483726 5:41963725-41963747 AAGGAGGAGCAGGAAGAGGAAGG + Intergenic
989710177 5:44388612-44388634 AAGCAGCAGCAGCAGCAGCCGGG + Exonic
989717238 5:44478676-44478698 AAGGAGCAGTTGAAGGAGTAAGG + Intergenic
990184216 5:53195736-53195758 AGGGAAGAGTAGAAGCAGGAAGG + Intergenic
990225748 5:53650708-53650730 AGAAAACAGCAGAAGCAGGAAGG - Intronic
990526483 5:56633170-56633192 AAGGAGGAGCAGGAGGAGGGAGG + Intergenic
990537992 5:56742731-56742753 AAGGAGAAGAAGAAGAAGGGGGG - Intergenic
990825520 5:59893682-59893704 CAGCAGCAGCAGCATCAGGAAGG - Exonic
991036402 5:62131940-62131962 AGGGAGCAGGAGAAGGGGGATGG - Intergenic
991646788 5:68808300-68808322 AAGGAGGAAGAGAGGCAGGAAGG + Intergenic
992754230 5:79889171-79889193 AAGGAGAAGCTGTAGCAGAATGG + Intergenic
993012669 5:82501263-82501285 AAGGTGCAGAAGAAGGTGGAAGG - Intergenic
993021136 5:82592477-82592499 GAGGAGGAGGAGAAGGAGGAAGG - Intergenic
993044702 5:82854103-82854125 AAGGAGCAGCATAAGCAAAATGG + Intergenic
993402602 5:87472475-87472497 AAGGGCGAGCAGAAGCAGGGCGG + Intergenic
993569182 5:89515018-89515040 AAGGAGGAGGAGGAGAAGGAAGG + Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994203819 5:97009680-97009702 AAATAGCAGCAGCAGCAGCAAGG - Intronic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
994793717 5:104265884-104265906 AAGAAGGAGGAAAAGCAGGAAGG + Intergenic
995350824 5:111173459-111173481 AAGGAACAGCAGCAGAAGGAAGG + Intergenic
995790742 5:115883499-115883521 AAGGGTGAGCAGAAGCAGGGTGG - Intronic
995873473 5:116766178-116766200 AGAAAACAGCAGAAGCAGGAAGG - Intergenic
996030669 5:118700929-118700951 AAGCAGCAGCAGATCTAGGATGG - Intergenic
996524725 5:124466585-124466607 AAGGAGCAGCAGAAACACTGTGG + Intergenic
996552308 5:124743863-124743885 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
996910963 5:128656268-128656290 GAGGGGGAGCAGAAGCAGGATGG - Intronic
997028672 5:130096826-130096848 AAGGAGGAGGAGAATCTGGAAGG + Intronic
997051183 5:130382510-130382532 AAGAAGGATCAGATGCAGGAAGG + Intergenic
997430510 5:133836780-133836802 AAGGAACAGCGGAAGCTTGAAGG - Intergenic
997462978 5:134067624-134067646 AAGGAGGAGGAGAAGGAGAAGGG + Intergenic
998408064 5:141885742-141885764 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
998799638 5:145856365-145856387 CAGGAGCAGCAGCAGCAGCTAGG - Intergenic
998874337 5:146584095-146584117 AATGAGCAGCAGGGGCGGGAAGG + Intronic
998977002 5:147659328-147659350 GAGAACCAGCAGAAGCAGGGTGG - Intronic
999137219 5:149329952-149329974 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
999232186 5:150068239-150068261 CAGGAGCAGCAGCAGCAGCAAGG + Exonic
999409172 5:151335422-151335444 GAGGACCAGCAGCACCAGGAAGG + Exonic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
1000113609 5:158133017-158133039 AGGGAACAGCAGAAGAAGGGTGG + Intergenic
1000152148 5:158513834-158513856 AACGAGGAGGAGAAACAGGAGGG + Intergenic
1000194858 5:158947487-158947509 GAGGGCGAGCAGAAGCAGGACGG - Intronic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000518740 5:162273688-162273710 GAGAAACAGCAGATGCAGGAAGG + Intergenic
1000747655 5:165055053-165055075 GAGGAGGAGTAGAAGGAGGAAGG - Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001086196 5:168701636-168701658 AAGGAGAAGCAGGAGCCAGAAGG - Intronic
1001135282 5:169097699-169097721 GCGCAGCAGCAGTAGCAGGAGGG + Intronic
1001313641 5:170628022-170628044 AAGCAGGAGCAGAAGGAAGAGGG - Intronic
1001543711 5:172557113-172557135 AGGGAGCAGAAGCAGGAGGAGGG - Intergenic
1001887227 5:175303958-175303980 AATGAGTAGCGGAAGGAGGAAGG - Intergenic
1001960101 5:175874800-175874822 GAGGGGCAGGAGAGGCAGGAGGG + Intronic
1002353269 5:178600748-178600770 AATGAGCAGCAGCAGCAAGCTGG + Intergenic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1002972715 6:2040694-2040716 AGAAAACAGCAGAAGCAGGAAGG + Intronic
1003105395 6:3211326-3211348 AGGGAGCAGGAGGAGGAGGATGG - Intergenic
1003192467 6:3886649-3886671 AAGGCCCTGCAGAAACAGGACGG + Intergenic
1003402685 6:5803949-5803971 CAGGAACAGTAGAAGTAGGAAGG + Intergenic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003681613 6:8263138-8263160 AAGGAGGAGGAGAGGAAGGAAGG - Intergenic
1003870388 6:10398307-10398329 CAGCAGTAGCAGCAGCAGGAAGG + Exonic
1003875684 6:10434254-10434276 GAGGAGCAGTCGAAGAAGGAGGG + Intergenic
1004015643 6:11729464-11729486 AAGGAGCAGCAAAGGTAGCAAGG - Intronic
1004070213 6:12290676-12290698 AAGGAGCTCCAGAAACAGGTAGG + Exonic
1004086741 6:12457086-12457108 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1004343571 6:14828390-14828412 AAGGAGCTGCAGAAAAAGGAGGG + Intergenic
1004420614 6:15466235-15466257 AGGAAACAGGAGAAGCAGGAGGG - Intronic
1004462714 6:15853428-15853450 AAGGAGAAGCAGAAGGGGAAGGG - Intergenic
1004462717 6:15853434-15853456 AAGAAGAAGGAGAAGCAGAAGGG - Intergenic
1004577035 6:16906893-16906915 AAGGAGGAGGAGAGGAAGGAAGG + Intergenic
1004698444 6:18056050-18056072 AAGAAGCCGCAGAAGTTGGAGGG - Intergenic
1004945583 6:20609260-20609282 AAGGAGGAGAAGGAGGAGGAAGG - Intronic
1004945609 6:20609354-20609376 AAGGAGAAGGAGAAGAAGGGAGG - Intronic
1005081954 6:21965396-21965418 GAGGAGGAGAAGAAGGAGGAGGG - Intergenic
1005248925 6:23921639-23921661 AAGAACCATCAGAAGCTGGAAGG + Intergenic
1005364887 6:25066925-25066947 AAAAAGCAGCAGATACAGGATGG + Intergenic
1005455688 6:26017687-26017709 CAGGAGCAGCAGAAGCGGCGGGG + Exonic
1005495450 6:26383862-26383884 GAGGAGCAGGAGGAGGAGGAGGG - Exonic
1005734278 6:28731174-28731196 AAGGAGCAGGAGAGGGAGCAAGG + Intergenic
1005948313 6:30611664-30611686 GAGCAGCAGCAGAAGCAGGGAGG + Intronic
1005979194 6:30823434-30823456 AAGGAGGAGAAGAAGAAGAAGGG - Intergenic
1006131233 6:31870656-31870678 GATGAGCATCAGCAGCAGGATGG + Exonic
1007036263 6:38677144-38677166 AAGGAACAGCTGAAATAGGAAGG + Exonic
1007342578 6:41200976-41200998 CAGCAGCAGCAGCAGCAGGAAGG + Exonic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1007481902 6:42155718-42155740 AAGGGGCAGAGGAAGCAAGATGG - Intronic
1007576681 6:42929617-42929639 CAGCAGCAGCAGCAGCAGCAAGG - Exonic
1007751200 6:44073025-44073047 GAGGTGCAGCAGAGGCAGGCGGG + Intergenic
1007827105 6:44608762-44608784 GAGGAGGAGGAGAAGGAGGATGG - Intergenic
1008366087 6:50682293-50682315 AAGGAGGAAGAGAAGCAGGGAGG - Intergenic
1008535352 6:52503094-52503116 ACGGAGCATCACAGGCAGGAAGG + Exonic
1008664336 6:53701243-53701265 TAGCAGAAGCAGAAGCATGAAGG - Intergenic
1008700933 6:54098481-54098503 AAGGAGGAGGGGAAGCAGGGAGG + Intronic
1009570095 6:65374233-65374255 AAGGGTGAGCAGAAGCAGGGTGG + Intronic
1009671177 6:66753099-66753121 AAGGAGGAAGAGAGGCAGGAAGG + Intergenic
1009722748 6:67495720-67495742 AAGGAGAAGGAGAAGTAGTATGG + Intergenic
1009775822 6:68205455-68205477 GAGGGCCAGCAGAAGCAGGGTGG + Intergenic
1009815987 6:68736118-68736140 CAGGAGAGGCTGAAGCAGGAGGG - Intronic
1010748245 6:79588527-79588549 GAGAAGCAGCAGATGCAGGAAGG - Intergenic
1010765215 6:79771057-79771079 AGAAAACAGCAGAAGCAGGAAGG - Intergenic
1011166431 6:84452516-84452538 AAGGAGCAGCTGTTGAAGGATGG + Intergenic
1011421332 6:87176540-87176562 AGAAAGTAGCAGAAGCAGGAAGG - Intronic
1011484802 6:87830171-87830193 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1011626923 6:89290543-89290565 GAAGGGCAGGAGAAGCAGGAGGG + Intronic
1011750053 6:90446566-90446588 AAGAAGCAGCAGAAGCCAGGTGG + Intergenic
1012083159 6:94785735-94785757 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1012232525 6:96777215-96777237 AAGGAGAAGGAGAAGAAAGAGGG - Intergenic
1012247165 6:96938632-96938654 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1012596006 6:101041074-101041096 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1012668918 6:102015653-102015675 AAGCAGTAGCAGCAGCAGCACGG - Intronic
1012713184 6:102634369-102634391 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1013393689 6:109713284-109713306 CAGCAGCAGCAGAGGCAGCATGG + Intronic
1013424945 6:110003160-110003182 AAGAATAAGCAGAAGAAGGAAGG + Intergenic
1013732774 6:113188395-113188417 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
1014103867 6:117541510-117541532 AAGGAGGAACAGAGGTAGGAGGG + Intronic
1014331487 6:120071209-120071231 ATGGAGTAGGAGAAGCAAGATGG - Intergenic
1014523981 6:122479044-122479066 AAGGGCAAGCAGAAGCAGGGTGG - Intronic
1014528047 6:122524115-122524137 AAGGAGGAGGAGAAGGAAGAAGG - Intronic
1014618614 6:123636898-123636920 AAGAAGCAGCAGAAACAGCCAGG - Exonic
1015106732 6:129545362-129545384 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015709403 6:136122760-136122782 AAGGGGCAACAGAAGCACTAAGG + Intronic
1015824834 6:137300625-137300647 AGAGAACAGCAGAAGCAGGAAGG - Intergenic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016330103 6:142945960-142945982 GAGGAGGAGGAGAAGGAGGACGG + Intergenic
1016560667 6:145392419-145392441 AAGGAGCAGTAGAAGGAGAATGG - Intergenic
1016645810 6:146406876-146406898 AAGGAGAAGAAGAAGAAAGAAGG + Intronic
1016801470 6:148173501-148173523 AAGGAGAAGGAGAAGAAGAAGGG + Intergenic
1016915157 6:149237813-149237835 AAGGACCAGCAGAAGCCTGCTGG - Intronic
1016919577 6:149278726-149278748 AAGGAGAAGTAGAGGAAGGAAGG + Intronic
1017055392 6:150431432-150431454 ATGTAGAACCAGAAGCAGGAGGG + Intergenic
1017236553 6:152122559-152122581 GAGGAGCAGGAGAAGCTGAAGGG + Exonic
1017297236 6:152812085-152812107 AAGGAGGAGGAGAAGAAGGAAGG - Intergenic
1017339591 6:153305279-153305301 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1017669517 6:156756648-156756670 AAGGAGAAGGAGAGGAAGGAAGG + Intergenic
1017995971 6:159531960-159531982 GAGCAGCAGCAGAAGGAGAAGGG - Intergenic
1018166079 6:161098317-161098339 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1018333513 6:162759945-162759967 AAGGAGCAAGTGAAGCAAGAGGG + Intronic
1018341834 6:162858960-162858982 AAAACGCCGCAGAAGCAGGAGGG - Intronic
1018783663 6:167091745-167091767 AAGCAGCATCAGAGCCAGGAAGG + Intergenic
1018805715 6:167258152-167258174 GAGGGGGAGCAGAAGCAGGGTGG + Intergenic
1019010405 6:168839952-168839974 TAGGGGCAGAGGAAGCAGGATGG + Intergenic
1019032297 6:169024112-169024134 AATCAGCAGCAGAAGCAGAGGGG + Intergenic
1019178638 6:170174164-170174186 CAGAAGCAGCAGAAGCAGCTAGG - Intergenic
1019190429 6:170247644-170247666 GGGCAGCAGCAGAGGCAGGAGGG + Intergenic
1019208764 6:170386710-170386732 AGAGAGCAGAAGAAGAAGGAAGG + Intronic
1019293057 7:259745-259767 CAGGAGCTGCAGACGCAGGTAGG - Exonic
1019593948 7:1849802-1849824 CAGCGGCAGCGGAAGCAGGACGG + Exonic
1019797636 7:3063525-3063547 GAGGAGAAGCAGAAGAAAGAAGG - Intergenic
1019865849 7:3709371-3709393 AAGTAGGAGCAGCAGAAGGAAGG - Intronic
1020410710 7:7888864-7888886 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1020577336 7:9949778-9949800 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1020861460 7:13496940-13496962 AATGAGCAGCAGCAGCAGAAAGG + Intergenic
1021467343 7:20960017-20960039 AAGGAAAAGCATAAGAAGGAAGG - Intergenic
1021796946 7:24265354-24265376 AAGAAGCAGGAGAAGCAAGCAGG + Intergenic
1022171705 7:27837792-27837814 CAGCAGCAGCAGATGCAGGAAGG + Intronic
1022303801 7:29127607-29127629 AAAAAACAGCAGAAGCAGGAAGG + Intronic
1022812258 7:33881380-33881402 GTGTAGCAGCAGATGCAGGAAGG + Intergenic
1022898435 7:34776961-34776983 AAGGAGAAGAAGGAGAAGGAAGG - Intronic
1022964919 7:35463871-35463893 GAGAAGCATCAGAAGCAGGGTGG - Intergenic
1023045174 7:36204423-36204445 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1023168762 7:37369901-37369923 AAGGAGGATCAGAAGGAGTAGGG - Intronic
1023172286 7:37401329-37401351 AGAAAACAGCAGAAGCAGGAAGG + Intronic
1023565693 7:41521966-41521988 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1023743004 7:43297585-43297607 CAGGAGCAGCGGAGGCATGATGG - Intronic
1023763029 7:43484277-43484299 GAGGAGCAGGAAAGGCAGGACGG + Intronic
1023795728 7:43790301-43790323 AACCAGGAGCAGAAGCAGGAGGG - Intronic
1023821935 7:43985462-43985484 GAGGGGCAGGAGGAGCAGGAGGG - Intergenic
1023842630 7:44105666-44105688 AAGGAGAGCCAGAGGCAGGAGGG - Intronic
1024464886 7:49701433-49701455 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1024506546 7:50167084-50167106 AAGGAGCTGAGGAAGCAGGTAGG + Intergenic
1025058040 7:55780956-55780978 AAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1025284351 7:57650144-57650166 ACAGAGCAGAAGAAGCAGGAGGG + Intergenic
1025301637 7:57823156-57823178 AAAGAGCAGAAGGAGCAAGAGGG - Intergenic
1025607550 7:63050288-63050310 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1026191892 7:68136436-68136458 GAGGAGAAGGAGAAGAAGGAAGG + Intergenic
1026238030 7:68545772-68545794 AAGGAGGAGAAGGAGAAGGAGGG - Intergenic
1026284147 7:68948375-68948397 AAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1026294172 7:69036604-69036626 CAGGAGGAGGAGAAGCAGGTTGG + Intergenic
1026502387 7:70953725-70953747 AAGGCAAAGGAGAAGCAGGATGG + Intergenic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1026844623 7:73691437-73691459 AAGGATCAGCACTAGGAGGAGGG - Intronic
1027464935 7:78503593-78503615 AAGGAGGGGGAGAAGGAGGAGGG - Intronic
1027501521 7:78957847-78957869 AGGGAGCAGCAGCATCAGGCTGG - Intronic
1027572759 7:79891458-79891480 AAGGAGGAGAAGGAGGAGGAAGG + Intergenic
1028078779 7:86548247-86548269 GAGGATGAGCTGAAGCAGGATGG - Intergenic
1028361186 7:89968583-89968605 AAGAAGCTGAAGAACCAGGAGGG + Intergenic
1028652924 7:93170707-93170729 GAGGAGGAGCCGAAGCAGGGTGG - Intergenic
1029364839 7:100110088-100110110 AAGGACAAGCAAAAGCCGGAGGG + Intronic
1029414177 7:100432719-100432741 AGGAAGAAGCAGAGGCAGGAAGG + Intronic
1029466394 7:100727884-100727906 TAGGCCCAGCAGAAGCAGGAGGG + Intergenic
1029493057 7:100882712-100882734 GAGGAGGAGGAGGAGCAGGAAGG - Intronic
1029524551 7:101087077-101087099 GAGGAGGAGGAGAAGGAGGAGGG + Exonic
1029637466 7:101794510-101794532 AATGAAAAGCAGAAGCAGGTTGG + Intergenic
1029835143 7:103301514-103301536 AAGGAGAAACAGAAAAAGGAAGG + Intronic
1029923596 7:104292402-104292424 CAGGAGCAGGAGAATAAGGAGGG - Intergenic
1030182099 7:106720936-106720958 AAGCAGCACCAGAAGAAGCAAGG + Intergenic
1030358563 7:108570076-108570098 GAGGAGCAGCAGTAGTCGGAGGG + Exonic
1030568564 7:111191938-111191960 AAGCAGGAGCAGGAGTAGGAGGG + Intronic
1030835565 7:114279841-114279863 AAGGAAGATCAGAGGCAGGAGGG + Intronic
1030919031 7:115356861-115356883 CAGGAGAAGCAGAAGCAAGTTGG + Intergenic
1031007655 7:116492259-116492281 AAGGAGCAGGAGAAAAGGGAAGG + Intronic
1031053790 7:116972131-116972153 AGGGAGGAGCAGCAGCAGGGTGG + Intronic
1031374510 7:121007786-121007808 AAAGAGAAGCAGCAACAGGATGG - Intronic
1031413778 7:121471678-121471700 AATGAGCAGTGGAAGCAGGTTGG + Intergenic
1031539020 7:122970714-122970736 ACGGTGCAGCAGGAGCTGGAGGG - Intergenic
1031560902 7:123236790-123236812 AAGGAACAGAAGAAGAAAGAAGG - Intergenic
1031619815 7:123922714-123922736 GAGCAACAGCAGAGGCAGGAAGG - Intergenic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1032252728 7:130271895-130271917 ATGGAGTAGCAGATGCAGGAAGG - Intronic
1032466830 7:132151390-132151412 AAGGAGGAGGAGGAGGAGGAAGG + Intronic
1032523151 7:132561436-132561458 AAGGAGGAGGACAAGAAGGAGGG - Intronic
1032672628 7:134099260-134099282 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
1033069437 7:138188689-138188711 AGGGAGCAGCAAAGGCTGGAGGG + Intergenic
1033204674 7:139408371-139408393 AAAAAGCAGCAGCATCAGGATGG + Intronic
1033265649 7:139884456-139884478 AGGGAGCTGGAGCAGCAGGAAGG + Intronic
1033306419 7:140229306-140229328 AAGGAGCAGTTCAAGAAGGAAGG + Intergenic
1033331467 7:140420447-140420469 AAGAAGGAGCAGAAGGAGGCAGG + Intronic
1033586696 7:142779641-142779663 ATGGAGGAGCAGGAGCAGGAGGG - Intergenic
1034015882 7:147586033-147586055 AAGGTGAAACTGAAGCAGGAAGG + Intronic
1034132738 7:148735458-148735480 AGTGAGCAGGCGAAGCAGGAAGG - Intronic
1034166415 7:149028370-149028392 CAAGAGCAGCAGGAGCAGGAAGG + Exonic
1034220841 7:149444955-149444977 AAAGAGTAGCAGAAACAGGTGGG - Intronic
1034410985 7:150942129-150942151 GAGCAGGAACAGAAGCAGGAGGG - Intergenic
1034800485 7:154052685-154052707 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
1034900688 7:154906315-154906337 AAGGAGCAGCTGGGGCGGGAGGG + Intergenic
1036295213 8:7529236-7529258 AAGGAGGAGGAGAAGGGGGAGGG - Intergenic
1036327357 8:7791782-7791804 AAGGAGGAGGAGAAGGGGGAGGG + Intergenic
1036587731 8:10140331-10140353 AGAAAGCAGCAGAAGCAGGAAGG - Intronic
1036744064 8:11391512-11391534 AAGGAGTTCCAGAAGGAGGACGG - Intronic
1037143057 8:15540507-15540529 CAGCAGCAGCAGGAGAAGGAAGG - Exonic
1037483297 8:19325080-19325102 CAGGACCAGCAGACGCCGGAGGG - Intronic
1037513728 8:19609677-19609699 AAGGACCCAGAGAAGCAGGAGGG + Intronic
1037568836 8:20141556-20141578 AAGGGGAAGAAGAAGCAGGGAGG + Intergenic
1037598401 8:20373614-20373636 GAGGAGGAGGAGAAGAAGGAAGG + Intergenic
1037649886 8:20826645-20826667 AAGGAACAGCAGAAGATGGAAGG + Intergenic
1037651105 8:20839439-20839461 AAGGAGCCTGAGAAACAGGAAGG + Intergenic
1038039037 8:23708576-23708598 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1038974721 8:32681433-32681455 AAGGTGCAGAAGAAGGAGAAGGG - Intronic
1039630267 8:39103658-39103680 AAGGAGGTGCAGGAGCAGGACGG - Exonic
1040079772 8:43274918-43274940 GAGGAGGAGCAGGAGGAGGAGGG - Intergenic
1040564274 8:48552149-48552171 AAGGAGGAGCGAAAGGAGGAGGG - Intergenic
1040682569 8:49831081-49831103 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1041154969 8:54976733-54976755 GAGGACAAGCAGAAGCAGGGAGG + Intergenic
1041196816 8:55409024-55409046 AAGGAGCCACAGCACCAGGAGGG + Intronic
1041433240 8:57808309-57808331 AAGGAGCAGGAAGAGCAAGATGG + Intergenic
1041678652 8:60563599-60563621 AGGGAGTAGCTGAAGCAGGGTGG - Intronic
1041948842 8:63477263-63477285 AAACACCAGCAGAAGCAGAATGG - Intergenic
1042311110 8:67380170-67380192 ACTGAGCAGAAGAAGCAGGCTGG - Intergenic
1042478731 8:69280045-69280067 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043079690 8:75750719-75750741 AAGGAGAAGCAGGCGAAGGATGG - Intergenic
1044402245 8:91786183-91786205 GAGAAGCAGCAGCAGCAAGAAGG - Intergenic
1044954757 8:97468404-97468426 GAGGAACAGAAGAAGCAGGGAGG - Intergenic
1044972143 8:97630112-97630134 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1045042183 8:98236514-98236536 AAGGGGCAGAAAGAGCAGGAAGG + Intronic
1045716541 8:105053734-105053756 AAGTAGCAGCAGCAGCAGATAGG - Intronic
1045718320 8:105074908-105074930 CAGCAGCAGCAGCAGCGGGAGGG - Intronic
1045763180 8:105634970-105634992 AAGGAGCAGCAGCTCCATGATGG + Intronic
1045839269 8:106560855-106560877 GAGGATGAGCAAAAGCAGGATGG + Intronic
1045911846 8:107419215-107419237 AGGAAACAGCAGAAGCAAGAAGG + Intronic
1045931264 8:107629633-107629655 GAAAAACAGCAGAAGCAGGATGG + Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046053716 8:109054831-109054853 AAGGAGCAGGAGGAGGAGGAAGG - Intergenic
1046412653 8:113867375-113867397 AAGGAGGAGGAGAAGGAGAAAGG - Intergenic
1046421167 8:113984717-113984739 ATTGAGCAGGAGGAGCAGGAGGG + Intergenic
1046538280 8:115544853-115544875 AAGGAGGAGAAGAAGGTGGAGGG + Intronic
1046890516 8:119416588-119416610 CAGGAGATGGAGAAGCAGGAAGG - Exonic
1047336245 8:123939483-123939505 AAGGAGCAGGACAAGCAAGAAGG + Intronic
1047388245 8:124429283-124429305 AAGGAGGAGGAGGAGAAGGAAGG + Intergenic
1047742019 8:127814199-127814221 AAGGGGCTGGAGAAGGAGGATGG - Intergenic
1047958990 8:129997119-129997141 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1047998201 8:130357093-130357115 AAGGAGCAGCAGAAGCCTCTGGG - Intronic
1048224388 8:132570702-132570724 AAGGATCAGCTGCAGCAGGCTGG - Intergenic
1048274468 8:133055852-133055874 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1048278644 8:133088249-133088271 GAGGAGGAGGAGGAGCAGGAGGG - Intronic
1048417556 8:134243627-134243649 AAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1048417597 8:134243792-134243814 AAGGAGGAGAAGGAGGAGGAAGG + Intergenic
1048630183 8:136233948-136233970 GAGAATAAGCAGAAGCAGGATGG - Intergenic
1048643163 8:136387345-136387367 AAGGAGAAGCAGAGGGAGTATGG - Intergenic
1048742148 8:137572981-137573003 AAGGAACAGAAGAGGCAGAAGGG + Intergenic
1048752629 8:137697379-137697401 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1048765329 8:137837545-137837567 AAGCAGCAGCAGCAGCAGTTTGG + Intergenic
1048767402 8:137859932-137859954 AAGGAGGAGGAGCAGGAGGAGGG + Intergenic
1048787603 8:138066961-138066983 TTGGAGAAGCAGAAGCAGAAGGG + Intergenic
1048968775 8:139632432-139632454 AGGAAGCAACAGAAGCAGGTGGG + Intronic
1049365416 8:142234635-142234657 AGGGAGCTGCAGAGGCTGGAGGG - Intronic
1049445965 8:142631705-142631727 CAGGAGAAGCAGAACCGGGAGGG + Intergenic
1049777272 8:144412562-144412584 CAGGGACAGCAGCAGCAGGACGG + Exonic
1050010425 9:1180316-1180338 AAGGAGAAGAGGAAGCAGGAAGG - Intergenic
1050021280 9:1286972-1286994 AAGGAGAAGGGGAAGCAGAAGGG - Intergenic
1050241995 9:3646409-3646431 GCTCAGCAGCAGAAGCAGGAAGG - Intergenic
1050432961 9:5580667-5580689 AAGGTGCAGGAGAAGCAGGCAGG + Intergenic
1050506207 9:6352002-6352024 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
1050733242 9:8733808-8733830 GAGGAGCAGCAGCAGCAGCCTGG + Exonic
1050750698 9:8933163-8933185 AAGGGCGAGCAGAAGCAGGGTGG - Intronic
1051222870 9:14868924-14868946 CAGGAGGAGCAGCAGCAGCACGG + Exonic
1051507254 9:17840702-17840724 AAGGTCCAGCAGAGGCAGCAGGG - Intergenic
1051863472 9:21652146-21652168 GAGGAGGAGCTGAAGCAGGGTGG - Intergenic
1051875310 9:21786908-21786930 AAGGAGCTGCCAAAGAAGGATGG + Intergenic
1052343581 9:27386054-27386076 AAGGAAAAGCAGCAGCAGGATGG - Intronic
1052709966 9:32042154-32042176 GAGGAGCAGCAGCTGGAGGATGG - Intergenic
1052814666 9:33092251-33092273 AAGGAGGAGAAGTAGAAGGAGGG - Intergenic
1052830618 9:33212258-33212280 AGGGAGCAGCAGAAGAAGGGAGG + Intergenic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053037798 9:34840410-34840432 AAGGAGGAGGAGGAGAAGGAGGG - Intergenic
1053037827 9:34840535-34840557 AAGAAGAAGAAGAAGAAGGAAGG - Intergenic
1053053716 9:34981228-34981250 AGGGAGCAGCAGGACCAGAAAGG - Exonic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053456114 9:38234167-38234189 CAGGAGCAGGAGACGCTGGAGGG + Intergenic
1054850654 9:69843464-69843486 GAGGAGGAGGAGAAGTAGGAGGG - Intronic
1054991475 9:71331964-71331986 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055080644 9:72265115-72265137 AGAAAACAGCAGAAGCAGGAAGG - Intergenic
1055502575 9:76916288-76916310 AAAAAACAGCAGAAGTAGGAAGG + Intergenic
1055648183 9:78380472-78380494 AAGGAACAGCTGAAGAAAGATGG - Intergenic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1055823970 9:80301562-80301584 GAGGGCGAGCAGAAGCAGGATGG - Intergenic
1055840773 9:80500456-80500478 CAGCAGCAGCAGCAGCAGTACGG - Intergenic
1056040517 9:82660698-82660720 AAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1056666746 9:88587476-88587498 AAGGAGCAGCAGAGGAAGGGTGG + Intergenic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1057995961 9:99821927-99821949 GAGGAGGAGCAGGAGCTGGAGGG - Exonic
1058056713 9:100456119-100456141 AAAAAGCAGCAGATGCAGCATGG - Intronic
1058444577 9:105043431-105043453 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1058508222 9:105688350-105688372 AAGGAGCAGAAGATGAAGAAAGG + Intergenic
1058561863 9:106238872-106238894 AAGGAGCAACAGAGGAAGTAAGG - Intergenic
1059266114 9:113032613-113032635 AGGGAGCAGAAGATGAAGGAAGG + Intergenic
1059655533 9:116354226-116354248 AAGGAAGAGCAGAAGGAGCAAGG + Intronic
1059880831 9:118687104-118687126 ATGGAGTGGCTGAAGCAGGATGG - Intergenic
1060446494 9:123693425-123693447 AAGGAGCAACACAAGCAGGCTGG - Intronic
1060521490 9:124296552-124296574 CAGGAGCAGAAGAGGCAGGCAGG + Intronic
1060549052 9:124476625-124476647 AAGGGGCAGCAGAAGGAGTGGGG + Intronic
1060625852 9:125110651-125110673 AAGGTGAAGGAGAAGCAGGCAGG - Intronic
1060769810 9:126324555-126324577 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1060989402 9:127839457-127839479 AAGAAGCAGCAGGAGGAGGAAGG + Intronic
1061014211 9:127972608-127972630 AGCAAGTAGCAGAAGCAGGATGG + Intronic
1061489333 9:130936552-130936574 AGGGAGCAGCAGAGGAAGGCGGG + Intronic
1061536761 9:131255115-131255137 AAGGGTCAGCAGTGGCAGGAAGG + Intergenic
1061668646 9:132175344-132175366 AAGGAGCAAGAGGGGCAGGAGGG + Intronic
1061697460 9:132387577-132387599 AAAGAGCAGCAGAAGCCTGTGGG - Intronic
1061717750 9:132531547-132531569 AAGGAGCTGGAGAAGGAGGCAGG + Intronic
1062050506 9:134444402-134444424 AAGGAGGAGGGGAAGGAGGAGGG - Intergenic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062144991 9:134984186-134984208 TAGAAGCAGGAGAGGCAGGAAGG + Intergenic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062698528 9:137887540-137887562 ATAGACCAGCAGATGCAGGAAGG + Intronic
1062729815 9:138102643-138102665 CAGGAGGAGCGGCAGCAGGAGGG - Intronic
1203780101 EBV:96257-96279 GAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780105 EBV:96266-96288 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780114 EBV:96290-96312 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780133 EBV:96341-96363 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780138 EBV:96356-96378 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780143 EBV:96371-96393 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780148 EBV:96386-96408 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780152 EBV:96395-96417 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780157 EBV:96410-96432 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780161 EBV:96419-96441 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780166 EBV:96434-96456 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780170 EBV:96443-96465 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780195 EBV:96512-96534 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780199 EBV:96521-96543 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780204 EBV:96536-96558 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780208 EBV:96545-96567 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780213 EBV:96560-96582 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780217 EBV:96569-96591 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780228 EBV:96602-96624 GAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1185523701 X:760960-760982 AAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1185621959 X:1455469-1455491 CAGGAGCGGGAGAGGCAGGAAGG - Intergenic
1185688218 X:1948093-1948115 AAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1185688507 X:2133632-2133654 AAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1185764555 X:2715111-2715133 GAAGAGCTGCAGAAGAAGGAAGG - Intronic
1185888210 X:3801843-3801865 CAGGAGCTGGAGAGGCAGGAAGG + Intergenic
1185921758 X:4100849-4100871 AAGGAGGAGGAGAAACAAGAGGG + Intergenic
1186027814 X:5333110-5333132 AAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1186034478 X:5406171-5406193 AAAGAGGAGGAGAAGGAGGAAGG + Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186124716 X:6400918-6400940 AAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1186204551 X:7187681-7187703 AATGAACAGCAGAAGCTGGTAGG + Intergenic
1186470343 X:9816579-9816601 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1186572257 X:10727614-10727636 AACCAGCAGTAGCAGCAGGAAGG + Intronic
1186742220 X:12530472-12530494 AAGGAACTGCAGAAGCAGGGTGG + Intronic
1186821059 X:13288472-13288494 AAATAATAGCAGAAGCAGGAAGG - Intergenic
1186908744 X:14139037-14139059 AAGGAGGAGAAGAAGGAGAAGGG + Intergenic
1187213256 X:17250309-17250331 AGGGAGCAGCTGAACCAGGCTGG - Intergenic
1187521779 X:20020616-20020638 TAGCAGCAGCTGAGGCAGGAAGG - Intronic
1187649559 X:21387390-21387412 GAGGATCACCAGAACCAGGAAGG + Intronic
1187968539 X:24636944-24636966 AATGCCCAGCAGAAGCAGAATGG - Intronic
1188034346 X:25300094-25300116 AGAAAACAGCAGAAGCAGGAAGG + Intergenic
1188193129 X:27196830-27196852 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1188707882 X:33357715-33357737 CAGCAGCAGCAGTAGCAGTATGG - Intergenic
1188980182 X:36720425-36720447 AAGGAGAAGAAGAAGAAGAAGGG + Intergenic
1189105791 X:38233903-38233925 AAGCAGCAACAGAATCAGTAAGG - Intronic
1189175533 X:38953616-38953638 AGGGGGAAGCAGCAGCAGGAAGG - Intergenic
1189216660 X:39330930-39330952 AAAGAGAAGAAGAAGCAGGGAGG + Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189242055 X:39532943-39532965 GAGGAGCTGCAGAAGCATTAGGG - Intergenic
1189285645 X:39850518-39850540 AAGGAGGAGCAGAAACATAAGGG + Intergenic
1189627690 X:42916893-42916915 AACAAGCAGCAGAATCAGGCTGG + Intergenic
1189709704 X:43796555-43796577 AAGGAGGAGGAGAAAGAGGAGGG + Intronic
1190237924 X:48631671-48631693 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1190262365 X:48805472-48805494 AAGGAGCAACTGATCCAGGAGGG + Exonic
1191024202 X:55896238-55896260 GAGGACGAGCAGAAGCAGGGTGG + Intergenic
1191135488 X:57059245-57059267 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1191606165 X:63065475-63065497 GAGGGGAAGCAGAAGCAGGGTGG + Intergenic
1191842384 X:65522496-65522518 GAGGAGCAGGGGAAGCAGAATGG + Intronic
1192034132 X:67545399-67545421 AGGCAGCAGCAGCAGCAGCAGGG + Exonic
1192190291 X:68987140-68987162 GGGCAGCAGCAGAGGCAGGATGG - Intergenic
1192639091 X:72846163-72846185 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1192642620 X:72874642-72874664 GAGGAGGAGAAGAAGGAGGAGGG - Intronic
1192958257 X:76096140-76096162 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1193043882 X:77032069-77032091 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1193228498 X:79013712-79013734 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1193394396 X:80967449-80967471 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1193571597 X:83151536-83151558 GAGGACGAGCAGAAGCAGGGTGG + Intergenic
1193659291 X:84237610-84237632 AAGAAGCAGTAGGAGCATGAAGG - Intergenic
1194320297 X:92438482-92438504 AGAAAACAGCAGAAGCAGGAAGG + Intronic
1195112055 X:101658827-101658849 AGGGTGCAGCAAAAGCTGGATGG + Intronic
1195654754 X:107323938-107323960 ATGGAGCACGAGAGGCAGGAGGG + Intergenic
1196002790 X:110804709-110804731 AAGCAGCATCAGAATCTGGAAGG + Intergenic
1196047370 X:111270388-111270410 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1196054161 X:111336968-111336990 AAGGAGGAGGAGAAGAAGAATGG + Intronic
1196345254 X:114648318-114648340 AGAAAACAGCAGAAGCAGGAAGG - Intronic
1196367891 X:114943465-114943487 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1196603049 X:117623388-117623410 GAGGGTCAGCAGAAGCAGGGTGG - Intergenic
1196731105 X:118942311-118942333 AAGGAGAAGGAGAAGAAAGAAGG + Intergenic
1196806269 X:119589656-119589678 AAAGAGCAGCATAAGCGGGAAGG - Exonic
1196817771 X:119678596-119678618 AATGAGAAGGAGAAGCAGAAAGG - Intronic
1196914114 X:120514140-120514162 AAGGAGGAGCAGAAGCAACGGGG - Intergenic
1197051097 X:122060879-122060901 GAGGGCCAGCAGAAGCAGGGTGG + Intergenic
1197104996 X:122703134-122703156 TAGCAGCAGCAGCAGCAGGCAGG + Intergenic
1197184665 X:123573356-123573378 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1197499625 X:127228221-127228243 AAGGAGCAGCATGGGGAGGAGGG - Intergenic
1197762589 X:130038346-130038368 CAGGAGCTGCAGATCCAGGAGGG + Intronic
1197844211 X:130783910-130783932 AAGTTGCCGCAGAAACAGGAGGG - Intronic
1198012058 X:132567246-132567268 AAGTAGCTGCAGAGGCAGGTGGG + Intergenic
1198169275 X:134089916-134089938 AAGGTGAAGCAGAAGCAGGCAGG + Intergenic
1198330521 X:135618411-135618433 AAGGAGCAGAAGAAGAGGTAAGG + Intergenic
1198336407 X:135670585-135670607 AAGGAGCAGAAGAAGAGGTAAGG - Intergenic
1198645577 X:138802388-138802410 AAGGGTGAGCAGAAGCAGGATGG - Intronic
1198683972 X:139208372-139208394 TAAGAGCAGCAGAGACAGGATGG - Intronic
1198767210 X:140091743-140091765 ATGGAGGAGCAGCAGAAGGAGGG + Intergenic
1198801552 X:140452791-140452813 CAGGGGTAGCAGAGGCAGGAAGG + Intergenic
1199467242 X:148152515-148152537 TGGCAGCAGCAAAAGCAGGAAGG - Intergenic
1199751549 X:150824131-150824153 GAGGAGGAGGAGAAGAAGGAAGG + Intronic
1199774192 X:150996524-150996546 AGTGAGGAGCAGAAGCAGGTTGG + Intergenic
1199849414 X:151714794-151714816 AAGGAGGAAAAGAAGAAGGAAGG - Intergenic
1199991398 X:152989577-152989599 AAGGAGGAGCAGGAGGAAGAGGG - Exonic
1200139007 X:153888332-153888354 AAGTCCCAGGAGAAGCAGGAGGG + Intronic
1200292709 X:154887189-154887211 GAGGAGCAGCAGCAGCACGCGGG - Exonic
1200337944 X:155369833-155369855 GAGGAGAAGCAGGAGAAGGAGGG + Intergenic
1200339553 X:155382929-155382951 GAGGAGCAGCAGCAGCACGCGGG - Exonic
1200346917 X:155457764-155457786 GAGGAGCAGCAGCAGCACGCGGG + Exonic
1200348526 X:155471393-155471415 GAGGAGAAGCAGGAGAAGGAGGG - Intergenic
1200628416 Y:5551612-5551634 AGAAAACAGCAGAAGCAGGAAGG + Intronic
1201065770 Y:10092792-10092814 AAGGGGGAGCAGAGGCAGGGCGG + Intergenic
1201300197 Y:12498569-12498591 AAGCAGCAGCAGGAGCGGCAGGG - Intergenic
1201300219 Y:12498670-12498692 AAGCAGCAGCAGGAGGAGGAGGG - Intergenic
1201461675 Y:14232565-14232587 AAGAAGAAGCAGAAGAAGGAAGG - Intergenic
1201487753 Y:14510210-14510232 AAATACCAGCAGAAGCAGAATGG + Intergenic
1201563660 Y:15344161-15344183 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1201564595 Y:15353177-15353199 AGTGAGCAGCAGAAGCAAGTTGG + Intergenic
1201590552 Y:15610496-15610518 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1201943347 Y:19483210-19483232 AAGCAGCAGCACTAGCAGCAAGG - Intergenic