ID: 1154966731

View in Genome Browser
Species Human (GRCh38)
Location 18:21365723-21365745
Sequence GTCTGTCAAGTCTGCATTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 144}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154966731_1154966733 0 Left 1154966731 18:21365723-21365745 CCATAAATGCAGACTTGACAGAC 0: 1
1: 0
2: 1
3: 15
4: 144
Right 1154966733 18:21365746-21365768 TTATTCAACTTACTTTTAGTGGG 0: 1
1: 0
2: 2
3: 36
4: 378
1154966731_1154966735 2 Left 1154966731 18:21365723-21365745 CCATAAATGCAGACTTGACAGAC 0: 1
1: 0
2: 1
3: 15
4: 144
Right 1154966735 18:21365748-21365770 ATTCAACTTACTTTTAGTGGGGG 0: 1
1: 0
2: 0
3: 17
4: 188
1154966731_1154966734 1 Left 1154966731 18:21365723-21365745 CCATAAATGCAGACTTGACAGAC 0: 1
1: 0
2: 1
3: 15
4: 144
Right 1154966734 18:21365747-21365769 TATTCAACTTACTTTTAGTGGGG 0: 1
1: 0
2: 2
3: 14
4: 244
1154966731_1154966732 -1 Left 1154966731 18:21365723-21365745 CCATAAATGCAGACTTGACAGAC 0: 1
1: 0
2: 1
3: 15
4: 144
Right 1154966732 18:21365745-21365767 CTTATTCAACTTACTTTTAGTGG 0: 1
1: 0
2: 0
3: 15
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154966731 Original CRISPR GTCTGTCAAGTCTGCATTTA TGG (reversed) Intronic
905693339 1:39958146-39958168 GTCTGGAGAGTCTGTATTTAGGG + Intronic
906699237 1:47845677-47845699 GTGTTTAAAGTCTGCTTTTAGGG + Intronic
906699667 1:47848790-47848812 GCCTGTCAAGTCTGGCTGTATGG + Intronic
907786552 1:57618443-57618465 GGCTGACAAGTCTTCCTTTAGGG + Intronic
907921166 1:58913566-58913588 GTCAGTCTAGCTTGCATTTATGG - Intergenic
910915758 1:92286903-92286925 GGCTGGGAAGTCTGCAATTAAGG - Intronic
913212372 1:116592265-116592287 TTCTTTCACGTCTGCATTTATGG - Intronic
913660164 1:120999957-120999979 GTCAGTCAAGGCTGTAGTTATGG - Intergenic
913670323 1:121092319-121092341 GTCTTCCAAGGCTGCAGTTAGGG + Intronic
914011527 1:143783113-143783135 GTCAGTCAAGGCTGTAGTTATGG - Intergenic
914022090 1:143879760-143879782 GTCTTCCAAGGCTGCAGTTAGGG + Intergenic
914166306 1:145178021-145178043 GTCAGTCAAGGCTGTAGTTATGG + Intergenic
914650154 1:149691773-149691795 GTCAGTCAAGGCTGTAGTTATGG - Intergenic
914660575 1:149787689-149787711 GTCTTCCAAGGCTGCAGTTAGGG + Intronic
917342867 1:173997709-173997731 GTCTCTCAAACCTGTATTTATGG - Intronic
918372291 1:183873051-183873073 CTAAGTCAAGTCTGCATTTTAGG + Intronic
919528313 1:198681388-198681410 GACTATCAAGTGTGTATTTAAGG + Intronic
923788180 1:237088212-237088234 GTCTGGCATGTTTGCATTTGTGG + Intronic
924136025 1:240967739-240967761 GTCTGTCCAGTCTTCTTTGAAGG - Intronic
924246341 1:242088988-242089010 AGCTATCAAGTCTGCATTTTGGG - Exonic
1063453854 10:6169470-6169492 GTGGGTCTACTCTGCATTTATGG - Intronic
1065201178 10:23314586-23314608 GTCTCCCAAGGCTGCAATTAAGG + Intronic
1067991914 10:51223776-51223798 ATCTGTCAAGTCTACTTTTAAGG - Intronic
1069012131 10:63386220-63386242 GTCTGTGAAGTTTGTATTTAGGG - Intronic
1070141849 10:73744288-73744310 TTCTGCCACGTCTGCATTTCGGG - Intergenic
1072889033 10:99305170-99305192 GTCTGTCAAGTCTCCAATTTTGG - Intergenic
1075542701 10:123328929-123328951 GTGTGACATGTTTGCATTTATGG + Intergenic
1076348867 10:129801014-129801036 GTCTGTCCAGTCTGCAGCTGCGG - Intergenic
1080075030 11:28138970-28138992 CTCTGTGAAGTCTGGATTAATGG - Intronic
1083312979 11:61794957-61794979 GTCTTTCAGGTCTGCCATTATGG + Intronic
1086928836 11:92670302-92670324 GAGTGTGAAGTCTGCTTTTAAGG - Intronic
1087746416 11:101952775-101952797 GACTGTCATGTCTACATTCATGG - Intronic
1088938522 11:114429343-114429365 GTTTGTAGAGTCTGCCTTTATGG + Intronic
1092306238 12:7304046-7304068 GTCTGACAATTCTGTAGTTAAGG + Intergenic
1093314732 12:17634166-17634188 TTCTGACAAGTCTGCATGTCAGG + Intergenic
1093727482 12:22531810-22531832 GTCTGTAGACTCAGCATTTATGG - Intronic
1096379022 12:51139635-51139657 GTCTGTCATGTCAGCACTTTAGG - Intronic
1097482027 12:60140353-60140375 CTATGTGTAGTCTGCATTTAAGG + Intergenic
1097785478 12:63754101-63754123 GTCTGCCAATTCTCCATTTAGGG - Intergenic
1100772451 12:97938463-97938485 GCCTGTCAAGTTTTCCTTTAAGG + Intergenic
1101182597 12:102235661-102235683 GTCTTTCAAGTCTGGATTATGGG + Intergenic
1101207360 12:102501918-102501940 GTCTGTCTATTCTGCAATCATGG - Intergenic
1103313777 12:120034658-120034680 GTCTCACAATTCTGCATTCAAGG + Intronic
1104707385 12:130957671-130957693 TTCTTCCAAGTCTGGATTTAGGG + Intronic
1105107445 13:16558336-16558358 CTCTGTGATGTCTGCATTCAAGG + Intergenic
1105215617 13:18282888-18282910 TTCTTTCACGTCTGCATTTATGG - Intergenic
1107685536 13:42894188-42894210 GTCTGTCAAGTATTTATTAAAGG + Intronic
1107862887 13:44677474-44677496 AGATGTCAAGTTTGCATTTAAGG - Intergenic
1108467470 13:50731126-50731148 GTCGGCCAAGTCTTCATTTATGG + Intronic
1110554094 13:76839028-76839050 GTTTGTCAGGTCTGCCATTAAGG + Intergenic
1112921953 13:104625096-104625118 TTCTGTCAAGTTTGCATGTGTGG - Intergenic
1114192353 14:20449556-20449578 TACTATCAAGACTGCATTTAAGG - Intronic
1115508598 14:34117467-34117489 GTCTGTGAAGTTTGGAATTATGG - Intronic
1117556492 14:56891334-56891356 GTCAGGCAAATCTGGATTTAGGG - Intergenic
1118236554 14:64010430-64010452 TTCTGTCAAGCCTGCAATGAAGG - Intronic
1121112957 14:91324780-91324802 GTCTGACAAGTCTGCGTTCTTGG + Exonic
1121913577 14:97815428-97815450 ATCTGTGAAGTCTTCATTTGCGG + Intergenic
1122184382 14:99979515-99979537 GTCTGTCGATTCTGCATCTGTGG + Intronic
1123783702 15:23648025-23648047 GTCTGACTGGTCTGCATTTGGGG - Intergenic
1124660964 15:31550607-31550629 GTCTCTCAAGGCTGAAATTAAGG - Intronic
1126404221 15:48306060-48306082 GTCTGGTCAATCTGCATTTAGGG - Intergenic
1128811929 15:70579235-70579257 GTCTTTCAGGACTACATTTACGG - Intergenic
1129031758 15:72623824-72623846 GTGTGTCAAGGCTACATTTTAGG - Intergenic
1129735294 15:77957686-77957708 GTGTGTCAAGGCTACATTTTAGG + Intergenic
1130704397 15:86218893-86218915 GTCTGACAAGGCTGCAATCAAGG - Intronic
1132312101 15:100864700-100864722 ATCTGTCAAGTCTGCTCTCAGGG + Intergenic
1133302267 16:4789716-4789738 GTCTGTAATCTCAGCATTTAGGG - Intronic
1133851804 16:9511706-9511728 GTCTGCCAAATCTGCATTGGAGG + Intergenic
1137989362 16:53137421-53137443 TTCTGTCAAGTTTGTATTTCTGG + Intronic
1140024465 16:71272393-71272415 TTCTGTAAACTCTGCAATTAAGG - Intergenic
1140956792 16:79873935-79873957 ATCTGTCAAGTGTGGTTTTAGGG + Intergenic
1143275047 17:5704055-5704077 GTCTTCCAAGTCTCCATTCAGGG + Intergenic
1144391430 17:14797179-14797201 TTCTGCCAACTCTGCTTTTACGG + Intergenic
1150501464 17:65654733-65654755 GTCTGGTAAGTCTGCCTCTAAGG + Intronic
1150530003 17:65968031-65968053 GTATGTAAACTCTGCATATATGG - Intronic
1151070631 17:71206565-71206587 ATCTTTTAAGTCTGCAGTTATGG + Intergenic
1154966731 18:21365723-21365745 GTCTGTCAAGTCTGCATTTATGG - Intronic
1155317856 18:24590192-24590214 GTCTCACAAGTCTGCAATCAAGG - Intergenic
1156082908 18:33361452-33361474 GTCTTTGAAGTCTGAATTTTTGG - Intronic
1156524739 18:37756282-37756304 GTCTGTCAAGACTGCTTGGATGG + Intergenic
1156744698 18:40374996-40375018 ATATCTCAAGTGTGCATTTAAGG - Intergenic
1160277665 18:77452529-77452551 GTCTGTCCAGTCTTCATGTTAGG + Intergenic
930913179 2:56655480-56655502 CTCTCCCAAGTCTGCATTCAAGG - Intergenic
933421314 2:82048877-82048899 ATCTGTAAATTCTGCATTTGTGG + Intergenic
934298714 2:91763837-91763859 TTCTTTCACGTCTGCATTTATGG + Intergenic
939025963 2:137014131-137014153 GTTTGTCAAGGCTGTATTGATGG - Intronic
941880777 2:170478009-170478031 AACTATCATGTCTGCATTTAAGG + Intronic
943312556 2:186344919-186344941 GTCTATGAAATCTGCTTTTAGGG + Intergenic
945596162 2:211796346-211796368 GTTTGTCAATTCTGCATTGATGG + Intronic
945611850 2:212013350-212013372 CTCTTTCAAGTCTGTATTTCTGG - Intronic
1168773580 20:431203-431225 GTGTGTCAAGTCTGCAGAGAAGG + Intergenic
951035133 3:17924657-17924679 GTCTGGCAACTCTAGATTTAGGG + Intronic
953792616 3:45959709-45959731 GTCAGTTAAGTCTGCATGTCGGG - Intronic
955200223 3:56845217-56845239 GTCTGACAAGGCTGCAATCAAGG - Intronic
955283998 3:57621296-57621318 GTATGTGAAGTATGGATTTAAGG - Intergenic
956092112 3:65679105-65679127 GTGTGTCAATTCTGCAGTGAAGG + Intronic
959399355 3:105880480-105880502 GTTTGTCAAGTCTACCTTAAAGG + Intergenic
960785255 3:121366151-121366173 GTCTATCAAGACTTCAATTATGG + Intronic
962567434 3:136676250-136676272 GTCTGTAAAGTCTACAGTAATGG - Intronic
964714590 3:159708581-159708603 GCCTGTCAAGTCCTCATTGATGG - Intronic
964766404 3:160182757-160182779 GTCTGTAATCTCTGCATTTTGGG + Intergenic
969864906 4:10068918-10068940 GTGGGTCAAGTATTCATTTAGGG + Intergenic
970777515 4:19693780-19693802 GTCTGACAAATCTTTATTTAAGG - Intergenic
971711666 4:30120578-30120600 GTCTGTCAAATTTCCAATTATGG - Intergenic
972054090 4:34778518-34778540 GTCTTGCAAATCTGCATTCAAGG + Intergenic
972777175 4:42252317-42252339 GTCTCTCAAGTCTGTAGTCAAGG + Intergenic
974304288 4:60111860-60111882 GTCTGTGATGTCTACATGTAGGG - Intergenic
979926461 4:126571930-126571952 TTCTGTCCAGTCTTCATTGATGG + Intergenic
983651547 4:170041117-170041139 TTCTATCAAGTCTGCTTTCATGG - Intergenic
984283063 4:177695675-177695697 TTCTTTCATGTATGCATTTAAGG + Intergenic
988925808 5:35990473-35990495 GACTGTTAATTCTGCATTTTGGG - Intronic
988934128 5:36066015-36066037 GACTGTTAATTCTGCATTTTGGG - Intronic
993234805 5:85290762-85290784 TTCAGTCAAGTCGACATTTAAGG - Intergenic
994005620 5:94834234-94834256 GTCTGCCCAGTCTGCATTGAAGG + Intronic
994754939 5:103782279-103782301 GTCTGACCACTCTGCCTTTAGGG - Intergenic
996350335 5:122533296-122533318 AATTGTGAAGTCTGCATTTAAGG + Intergenic
997046563 5:130326108-130326130 TTCTGTCAAATCTACATTTTAGG - Intergenic
997141260 5:131383174-131383196 GGGTGTCAAGTCTGCCATTAGGG + Intronic
999712389 5:154330167-154330189 CTCTGGCAAGTCTGCCTTTCAGG + Intronic
999907536 5:156158620-156158642 GTCCGTAAAGACTGCATTAATGG - Intronic
1000557778 5:162748119-162748141 CTCTGTCAAGCCTTCCTTTAAGG - Intergenic
1000956140 5:167545848-167545870 GCCTGTCAAGTCTGTACGTATGG - Intronic
1001151802 5:169235992-169236014 CTCTGTGAAGTCCACATTTAAGG + Intronic
1002655424 5:180742830-180742852 GTCTGTCAAGTCTGCAGTTTTGG - Intergenic
1003227689 6:4221349-4221371 GTTTGTGACCTCTGCATTTATGG - Intergenic
1003411470 6:5866757-5866779 GTCGGACAAGTCTGCAGTGAGGG + Intergenic
1004927087 6:20426515-20426537 GTTTTTCACGTCTGCAGTTATGG + Intronic
1005451167 6:25974132-25974154 GTCTGATAAGGCTGCAGTTAAGG + Intronic
1005464945 6:26103887-26103909 GTCCGCCAAGTTTGTATTTAAGG + Exonic
1007478419 6:42134418-42134440 GTCTGTAATCTCTGCATTTTGGG + Intronic
1010689890 6:78897294-78897316 GTCTGTTAAGTCTTCAATGAAGG - Intronic
1014151863 6:118066531-118066553 GTCTTTCAAGGCTGCAGTTAAGG - Intronic
1014824894 6:126038124-126038146 GTCTGTGAAGTCTACAAGTATGG + Intronic
1017983639 6:159423778-159423800 CTCAGTCAAGTCTGAATTCAGGG + Intergenic
1021041696 7:15870891-15870913 GTATGACAAGTCTTTATTTAAGG - Intergenic
1023118188 7:36883178-36883200 GCCTGTCATGTCAGCACTTAGGG + Intronic
1027403774 7:77836416-77836438 GTATGTTAAGTCTGCCTTTACGG - Intronic
1030447800 7:109669295-109669317 GTCTGTCAAGTCTGCATGCTGGG - Intergenic
1036008215 8:4691635-4691657 GCCTGTCATGTCTGCCTTGATGG + Intronic
1038201487 8:25417022-25417044 ATCTGTCAAGTTAGTATTTACGG - Intronic
1038255904 8:25950791-25950813 GCCTGTGAATTATGCATTTATGG - Intronic
1041202775 8:55467037-55467059 GTCTCACAAGGCTGCATTCAAGG + Intronic
1042064037 8:64854118-64854140 ATCAGTCAAATCTGCATTTAAGG + Intergenic
1043162561 8:76863868-76863890 GTCTGAAAAGTCTGCACTTTTGG - Exonic
1045248398 8:100463093-100463115 CTCTGGCAAGGCTGCCTTTAGGG + Intergenic
1053556548 9:39143825-39143847 GGCTGTCAATGCTACATTTAAGG - Intronic
1054089525 9:60832246-60832268 GGCTGTCAATGTTGCATTTAAGG - Intergenic
1054110936 9:61107804-61107826 GGCTGTCAATGTTGCATTTAAGG - Intergenic
1054337612 9:63820799-63820821 GCCTGTAATGTCTGCATTTTGGG - Intergenic
1054609921 9:67223321-67223343 GGCTGTCAATGTTGCATTTAAGG + Intergenic
1056424409 9:86462574-86462596 GGCTGTCAAATCTGTATTAAAGG - Intergenic
1058253189 9:102728499-102728521 GCATGTCAAGTCTGTATTTCAGG - Intergenic
1060382717 9:123191771-123191793 GTTTGTCAAGTCCTAATTTAGGG + Intronic
1186963660 X:14764149-14764171 GTCTCCCAAGGCTGCAATTAAGG + Intergenic
1188937129 X:36190566-36190588 GTCTATCAAGTCTCCATTCAAGG + Intergenic
1189733217 X:44043720-44043742 GTCTCACAAGGCTGCATTCAAGG + Intergenic
1191202968 X:57804325-57804347 CTTTATCCAGTCTGCATTTATGG + Intergenic
1192674412 X:73181007-73181029 GTATGTGCAGTATGCATTTAAGG - Intergenic
1199267585 X:145846281-145846303 GTCTGTTTTGGCTGCATTTAAGG - Intergenic
1200767748 Y:7094684-7094706 GTGTGTCATGTCTGCCTTCAAGG - Intergenic
1201286124 Y:12380170-12380192 GTCTTCAAAGTCTGCATTTTCGG + Intergenic