ID: 1154969989

View in Genome Browser
Species Human (GRCh38)
Location 18:21398303-21398325
Sequence GCCATTAACGCCTACCTTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 58}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154969989 Original CRISPR GCCATTAACGCCTACCTTGC CGG Intronic
900759868 1:4463410-4463432 TCCATTAACCCCTTCCTAGCTGG + Intergenic
903797324 1:25939639-25939661 GCCGTTAACGCCTAACGTGATGG + Intergenic
906042176 1:42796095-42796117 GCCACTAATCCCTACTTTGCAGG + Intergenic
914431970 1:147626792-147626814 TCCATTAGCACATACCTTGCAGG - Intergenic
916711813 1:167417328-167417350 GCCATTTAGACCTACCTAGCAGG - Exonic
919837272 1:201583480-201583502 GGCATTAACTCCTTCCCTGCTGG + Intergenic
924920939 1:248628341-248628363 GCCACTGAGGCCTACCATGCCGG - Intergenic
1068517824 10:58045849-58045871 GACATTAAGGCCTACCTGTCAGG - Intergenic
1071879128 10:89875446-89875468 GCCATTAACACAGACCTTGAAGG + Intergenic
1073050514 10:100664136-100664158 GATAATAACGTCTACCTTGCAGG + Intergenic
1074826417 10:117218110-117218132 GCCCTTAACAGCTCCCTTGCTGG - Intergenic
1076202172 10:128567590-128567612 GCCTTTAACACCTGCCTTGCTGG + Intergenic
1082853502 11:57786064-57786086 GCCATTAAGTCCTACATTACTGG - Intronic
1083959317 11:66005525-66005547 GCCATTAACACCCACCTGACTGG + Intergenic
1109987756 13:70012308-70012330 CCCTTTAATGTCTACCTTGCAGG + Intronic
1132121719 15:99181698-99181720 GCCATGAAAGCCTTCCCTGCTGG - Intronic
1132934269 16:2473048-2473070 GCCAGTGACGCCATCCTTGCAGG - Exonic
1133518259 16:6531010-6531032 GCCATTGTCCCCCACCTTGCAGG + Intronic
1133760750 16:8796690-8796712 GGCAATAACGGTTACCTTGCAGG - Intronic
1145797859 17:27666397-27666419 GGCATTGACGCCTGCTTTGCAGG + Intergenic
1145812307 17:27771733-27771755 GGCATTGACGCCTGCTTTGCAGG + Intronic
1148641076 17:49188081-49188103 GCCATTACCTCCTACCTCCCTGG - Intergenic
1149492741 17:57096756-57096778 GCCGCCAACACCTACCTTGCTGG - Exonic
1150966970 17:69982124-69982146 TCCATTAACAACTATCTTGCAGG + Intergenic
1152445467 17:80340239-80340261 GCCATCCAAGCCTACCTGGCAGG + Exonic
1154969989 18:21398303-21398325 GCCATTAACGCCTACCTTGCCGG + Intronic
925217233 2:2107546-2107568 GGCATTAGCTCCTACCTTTCGGG - Intronic
925640819 2:5984515-5984537 GGCAATAATGCCTACCTTGCTGG + Intergenic
927120569 2:19957010-19957032 GACAATAACGCCTACCTTATAGG - Intronic
948039171 2:234885841-234885863 GCCATTAACTCTTTCGTTGCAGG + Intergenic
1173225408 20:41159751-41159773 CCCCTTAACTCCCACCTTGCAGG - Exonic
1175142650 20:56872406-56872428 GCCATTGACCCCTCCCATGCTGG + Intergenic
1178837733 21:36112679-36112701 GACATTAATGTCTACCTTCCTGG - Intergenic
949282105 3:2358295-2358317 GACAGTAACACCTACCTCGCAGG + Intronic
956466677 3:69526649-69526671 GCCAATTATACCTACCTTGCAGG + Intronic
960946532 3:122970691-122970713 GGCAATAATACCTACCTTGCAGG - Intronic
962741581 3:138366118-138366140 GCCATTAACACACAGCTTGCAGG + Intronic
977126577 4:93176008-93176030 GCTATTAGCTCCTACTTTGCAGG - Intronic
982195646 4:152910103-152910125 GCCATTGCCGCTTACTTTGCTGG + Exonic
1001554074 5:172624466-172624488 GGCAGTAAGGCCCACCTTGCAGG + Intergenic
1001577818 5:172775568-172775590 GCCACTCAGGCCTACCTTGAGGG + Intergenic
1002006817 5:176240824-176240846 AACATTAATGCCTACCTAGCAGG + Intronic
1002219559 5:177669812-177669834 AACATTAATGCCTACCTAGCAGG - Intergenic
1002343621 5:178533007-178533029 TCCCTTAACCCCTGCCTTGCTGG + Intronic
1004931794 6:20469414-20469436 GCCTATAATGGCTACCTTGCTGG - Intronic
1009277674 6:61704484-61704506 GCCATTAGCAGCTACTTTGCTGG + Intronic
1015589545 6:134809648-134809670 GACAATAATGCCTACCTCGCAGG - Intergenic
1017753561 6:157510768-157510790 GCAATGAACGCCCCCCTTGCTGG - Intronic
1021483074 7:21139529-21139551 GACAATAAAACCTACCTTGCAGG - Intergenic
1039212422 8:35233081-35233103 AATAATAACGCCTACCTTGCAGG + Intergenic
1042174180 8:66022490-66022512 GCCATCAACTCTGACCTTGCAGG - Intronic
1047292677 8:123543165-123543187 GCCAATAATGCCTACCTTTCAGG + Intergenic
1047769136 8:128016572-128016594 TACATTAACTCCTCCCTTGCTGG + Intergenic
1051507228 9:17840529-17840551 GCTAATAATGCCTACTTTGCAGG - Intergenic
1052141489 9:24991097-24991119 GCCATTCACAGCAACCTTGCTGG + Intergenic
1053420890 9:37977236-37977258 GGCATCAGCACCTACCTTGCTGG - Intronic
1061221903 9:129257080-129257102 TCCATAGACGCCTCCCTTGCCGG + Intergenic
1186182599 X:6987478-6987500 GGCAGTAATACCTACCTTGCAGG + Intergenic
1186522005 X:10214292-10214314 CCCATTAACGCCGATATTGCTGG + Intronic
1187800837 X:23060851-23060873 GCAAATAACACCTACCTTACGGG + Intergenic
1188398814 X:29719408-29719430 GTAATTGATGCCTACCTTGCAGG - Intronic
1197641312 X:128971268-128971290 ACTATTAATACCTACCTTGCAGG - Intergenic