ID: 1154983468

View in Genome Browser
Species Human (GRCh38)
Location 18:21524408-21524430
Sequence ATAAGGCAGGTCCTCTTTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 29, 3: 19, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154983468_1154983472 25 Left 1154983468 18:21524408-21524430 CCTTCAAAGAGGACCTGCCTTAT 0: 1
1: 0
2: 29
3: 19
4: 116
Right 1154983472 18:21524456-21524478 TTTTAGTACAGCAGAATTTTTGG 0: 1
1: 0
2: 2
3: 33
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154983468 Original CRISPR ATAAGGCAGGTCCTCTTTGA AGG (reversed) Exonic
901761877 1:11477153-11477175 ATGAAGCAGGACCCCTTTGAAGG + Intergenic
903537186 1:24074705-24074727 AGAATCCAAGTCCTCTTTGAAGG + Intronic
908903869 1:68985805-68985827 ATTGGGCAGGGCGTCTTTGAAGG + Intergenic
912436702 1:109667233-109667255 TTAAGGTAAGTCCTTTTTGATGG + Intronic
913956034 1:143294578-143294600 AAAAGGCAGGTCATCTTTGAAGG - Intergenic
913981397 1:143520862-143520884 AAAAGGCAGGTCATCTTTGAAGG + Intergenic
914075770 1:144347517-144347539 AAAAGGCAGGTCATCTTTGAAGG + Intergenic
914103408 1:144618979-144619001 AAAAGGCAGGTCATCTTTGAAGG - Intergenic
916298822 1:163250616-163250638 AAAAGGCATTTCCTCTCTGAAGG - Intronic
918135872 1:181673633-181673655 ATAAGGGATGTCCTCTTTCTGGG - Intronic
919210381 1:194475196-194475218 AAAAGGAGAGTCCTCTTTGAAGG + Intergenic
920672420 1:208014746-208014768 ATAAGGCAGATCCGCTTTGTGGG + Intergenic
922055507 1:222038694-222038716 ATAGGGCAGGTCTTATTTGATGG + Intergenic
923200562 1:231706907-231706929 GTAAGGCAGGTTCCCTGTGAAGG - Intronic
1066782103 10:38962449-38962471 AAAAGGAAGGTCATATTTGAAGG + Intergenic
1066955012 10:42158177-42158199 AAAAGGAAGGTCGTCTTTGAAGG - Intergenic
1078168278 11:8909885-8909907 CTTAGGAAGGTCCACTTTGAGGG - Intronic
1088729853 11:112671089-112671111 ATAAGGTAGGTGCTCTGTGCTGG - Intergenic
1092642320 12:10527776-10527798 ATAAGGTAAGTCCTATTTTAAGG + Intergenic
1095436832 12:42198239-42198261 AAAAAGCAGATCCTCTATGAGGG - Intronic
1095771183 12:45959466-45959488 ATAAGGCATGGCCTGTTAGAAGG + Intronic
1098217538 12:68236125-68236147 ATAGGGCAGGTCCATTTGGAGGG + Intergenic
1099221167 12:79916545-79916567 AAAAGGCAAGTCATTTTTGAAGG - Intronic
1099851825 12:88108435-88108457 GTAGGGCAGGTCATATTTGAAGG - Intronic
1106924850 13:34603012-34603034 ATAGAGCAGATCCTCTTTTAAGG - Intergenic
1107328329 13:39269287-39269309 ATAAGGGAATGCCTCTTTGAGGG - Intergenic
1107543397 13:41414248-41414270 ATTAGGATGGTCATCTTTGAGGG + Intergenic
1108943786 13:55994717-55994739 ATAAGGCAACTTCTGTTTGAAGG - Intergenic
1109668736 13:65574993-65575015 ATTAGGAAGCTCCCCTTTGAGGG + Intergenic
1110623425 13:77624686-77624708 GTAAGGCAGGTCCTGGGTGATGG + Intronic
1112114777 13:96339842-96339864 AAAAGGAAGGTGCTCTTTGTGGG + Intronic
1116764868 14:49058055-49058077 ATAGATCAGGTCCTCTTTGGAGG + Intergenic
1118851519 14:69587318-69587340 AGAAGGCAAGTTCTCCTTGAAGG - Intergenic
1120480581 14:85044336-85044358 AAAAGGCAGGTTCTCTTGGGTGG - Intergenic
1120798002 14:88656704-88656726 AAAAGGCAGGTTGTCTTTAATGG - Intronic
1122926333 14:104904504-104904526 ACAGGGCGGGTCCTCTCTGATGG - Intergenic
1202938543 14_KI270725v1_random:118103-118125 AAAAGGCAGGTCATCTTTGAAGG - Intergenic
1123394656 15:19919788-19919810 AAAAGGCAGGTCATCTTTGAAGG + Intergenic
1125649970 15:41308491-41308513 ATTAGGCAGGCCTTCTTTTAAGG + Intergenic
1130061140 15:80570935-80570957 ATAAGGGAAGGCCTCCTTGAAGG - Intronic
1130109233 15:80950879-80950901 GCCAGGCAGGCCCTCTTTGAAGG - Exonic
1136700748 16:32138204-32138226 AAAAGGCAGGTCATCTTTGAAGG + Intergenic
1136766910 16:32789255-32789277 AAAAGGCAGGTCATCTTTGAAGG - Intergenic
1136801185 16:33081123-33081145 AAAAGGCAGGTCATCTTTGAAGG + Intergenic
1136936726 16:34474830-34474852 AAAAGGCAGGTCATCTTTGAAGG - Intergenic
1136945011 16:34639103-34639125 AAAAGGTAGGTCATCTTTGAAGG + Intergenic
1136947950 16:34678251-34678273 AAAAGGCAGGTCATCTTTGAAGG + Intergenic
1136955334 16:34778135-34778157 AAAAGGCAGGTCATCTTTGAAGG + Intergenic
1136959062 16:34824635-34824657 AAAAGACAGGTCATCTTTGAAGG + Intergenic
1136963093 16:34873740-34873762 AAAAGGCAGGTCATCTTTGAAGG + Intergenic
1136967184 16:34927944-34927966 AAAAGACAGGTCATCTTTGAAGG + Intergenic
1137085058 16:36109910-36109932 AAAAGGCAGGTCATCTTTGAAGG - Intergenic
1137087795 16:36150055-36150077 AAAAGCCAGGTCATCTTTGAAGG + Intergenic
1137092239 16:36208211-36208233 AAAAGGCAGGTCATCTTTGAAGG + Intergenic
1137221592 16:46457392-46457414 AAAAGGCAGGTCATCTTTGAAGG - Intergenic
1139155400 16:64435353-64435375 ATAAAGTAGGTCTTCTTTGCAGG - Intergenic
1203069305 16_KI270728v1_random:1051507-1051529 AAAAGGCAGGTCATCTTTGAAGG - Intergenic
1145186156 17:20795815-20795837 ATAAGACAGGTCTCCTTTGCTGG + Intergenic
1145324072 17:21784197-21784219 AAAAGGAAGGTCATCTTTGAAGG - Intergenic
1145326537 17:21834599-21834621 AAAAGGAAAGTCATCTTTGAAGG + Intergenic
1145689524 17:26723764-26723786 AAAAGGAAGGTCATCTTTCAAGG + Intergenic
1147973663 17:44235281-44235303 GTAAGGCAGGGCTTCTTGGAGGG - Intergenic
1148410969 17:47467026-47467048 ATAAGACAGGTCCCCTTTGTTGG - Intergenic
1203182794 17_KI270729v1_random:79733-79755 AAAAGGCAGGTCGTCTTTGAAGG + Intergenic
1154516479 18:15172584-15172606 AAAAGGCAGGTCATCTTTGAAGG - Intergenic
1154983468 18:21524408-21524430 ATAAGGCAGGTCCTCTTTGAAGG - Exonic
1161020946 19:2011260-2011282 AGGATGCAGGTCCTCTTTGGAGG - Intronic
1161306207 19:3570074-3570096 ATAAGGCAAGTCATCCTTAATGG + Intronic
1163255793 19:16155059-16155081 ATATGGCAGGTCCTTTCAGAGGG - Intronic
1165196520 19:34108305-34108327 ATAAAGCAGGTGCTCTTTTTAGG + Intergenic
1167834970 19:52061008-52061030 TTAAGTCAGGTCCTCAGTGATGG + Intronic
1202668961 1_KI270709v1_random:31627-31649 AAAAGGCAGGTCATCTTTGAAGG + Intergenic
932576876 2:72967448-72967470 GTCAGGGAGGGCCTCTTTGAGGG + Intronic
933145509 2:78847045-78847067 ATAATACAGGACCTCTTTGCAGG - Intergenic
934063313 2:88317326-88317348 ATAAGGAAGGCCCTGTTTTAAGG + Intergenic
934252330 2:90368239-90368261 AAAAGGAAGGTCATCTTTGAAGG - Intergenic
934257112 2:91434706-91434728 AAAAGGAAGGTCATCTTTGAAGG + Intergenic
934607751 2:95710359-95710381 AGAAGGCAGGACTTGTTTGAGGG + Intergenic
935825451 2:106944033-106944055 ATAATGCAGCTTCTATTTGATGG + Intergenic
936541093 2:113352239-113352261 AGAAGGCAGGACTTGTTTGAGGG + Intergenic
938162550 2:128998897-128998919 ATAAGGCAAGGCCACTCTGAAGG + Intergenic
938516800 2:132017578-132017600 AAAAGGCAGGTCATCTTTGAAGG - Intergenic
939041589 2:137195527-137195549 AGAATGCAGGTCCACTTTGAAGG + Intronic
942161907 2:173198044-173198066 ACAAGGGAGGTCCCCTTTAAAGG + Exonic
945184850 2:207129714-207129736 AAAAGTCAGGTCCTCCTTGTAGG - Intronic
946869034 2:224069411-224069433 ACTTGGCAGGTCCTCTCTGAAGG + Intergenic
1169237275 20:3941004-3941026 ATAAGGCTGTTCCTCCGTGAAGG + Intronic
1176344400 21:5728604-5728626 ATTGGGCAGGTCATATTTGAAGG - Intergenic
1176351214 21:5849188-5849210 ATTGGGCAGGTCATATTTGAAGG - Intergenic
1176500427 21:7595852-7595874 ATTGGGCAGGTCATATTTGAAGG + Intergenic
1176538721 21:8126673-8126695 ATTGGGCAGGTCATATTTGAAGG - Intergenic
1176584772 21:8571033-8571055 AAAAGGCAGGTCATCTTTGAAGG + Intergenic
1180267583 22:10547935-10547957 AAAAGGCAGGTCATCTTTGAAGG + Intergenic
1184418583 22:44366174-44366196 AGAAGGCAAGTGCTTTTTGAAGG - Exonic
1203243670 22_KI270733v1_random:43028-43050 ATTGGGCAGGTCATATTTGAAGG - Intergenic
1203325680 22_KI270738v1_random:13716-13738 AAAAGGAAGGTCATCTTTGAAGG - Intergenic
951075132 3:18381785-18381807 ATAAGAAATGTCCTCTTTTATGG + Intronic
951081100 3:18450804-18450826 AGAAGGCAGGCACTCTTTTAAGG + Intergenic
951085026 3:18502371-18502393 AAAAAGGAGGCCCTCTTTGAAGG - Intergenic
951359556 3:21708940-21708962 ATAAGGCAGTTTCTCCTTAAAGG + Intronic
952300960 3:32104382-32104404 ATCAGGTAGCTCCTCCTTGATGG - Intergenic
952834588 3:37592301-37592323 ATAAGGCTATTCCTCGTTGAAGG + Intronic
954948271 3:54445893-54445915 ACAAAGCAGTTCCTCTTTCAGGG - Intronic
959371291 3:105529424-105529446 ATAGTGCATGTCCTCTTTTATGG + Intronic
963314532 3:143744898-143744920 CCAAGGCAGGTCCTCTTAGTGGG - Intronic
965951698 3:174316584-174316606 ATCAGGCAGCACCTCCTTGATGG - Intergenic
967418816 3:189251354-189251376 TGAAGGCAGATTCTCTTTGAAGG + Intronic
968679983 4:1911204-1911226 AGAAGCCAGGTTCTCTTCGAAGG + Intronic
969617283 4:8261238-8261260 ACAAGGCAGGTGCACGTTGAGGG + Intergenic
969951826 4:10844714-10844736 ATAAGGTAGGACCTCATAGATGG + Intergenic
974258439 4:59492470-59492492 ATAAGACAGGTCTTGTTTAATGG + Intergenic
980013788 4:127624529-127624551 ATATGGCAGGGGCTCTTTGGGGG - Intronic
980388316 4:132114395-132114417 ATTAGACAGGTTCTCTTAGAGGG + Intergenic
980996984 4:139788724-139788746 AGGAGGCATGTCCTCTTTGACGG - Intronic
982952100 4:161712144-161712166 ATAAGGCATTTCCTTTTTGGGGG + Intronic
983963653 4:173784791-173784813 ATAAGCCGGGTCCTATCTGAGGG - Intergenic
984881751 4:184415547-184415569 GAAAGGCATGTCCTCTTTCAGGG - Intronic
990449416 5:55920744-55920766 ATAAGGACTGCCCTCTTTGAAGG + Intronic
991642216 5:68766365-68766387 ATAAGTCATGAACTCTTTGATGG + Intergenic
994946232 5:106395562-106395584 ATAATGCAGGTTCTTTTTCAGGG + Intergenic
995302829 5:110604359-110604381 ATAAGACAGCTACTATTTGATGG + Intronic
998251503 5:140556705-140556727 ATAAGTCAGGCACTGTTTGAGGG - Intronic
1000426263 5:161094127-161094149 AGTAGGCAGGTCCTCTCTGTAGG - Intergenic
1002322328 5:178383291-178383313 ATAAGGCAGGCCATCTCTGCGGG - Intronic
1004902522 6:20207256-20207278 ATACGGAAGGTCCTCACTGAAGG - Intronic
1008018548 6:46549062-46549084 ATATGGCAGGTGCATTTTGAGGG - Intergenic
1010376408 6:75175916-75175938 ATTGGTCATGTCCTCTTTGAAGG + Intronic
1013416298 6:109927808-109927830 ACAAGGCAGGTGGTATTTGATGG + Intergenic
1013590141 6:111612875-111612897 ATAAGGCAGGTGCTCACTGCAGG - Intergenic
1015170640 6:130248727-130248749 ATAAGGCAGGCTCTCCTTGAGGG + Intronic
1019009641 6:168833679-168833701 ATCTGGCAGCTCCTCTTTGGGGG + Intergenic
1022621018 7:31984703-31984725 CTGAGGAAGGTCCCCTTTGATGG + Intronic
1023926033 7:44670447-44670469 AGAGGGTAGGTCCTCTTTGAAGG + Intronic
1024807213 7:53157014-53157036 AAAAGGAAGGTCATCTTTGAAGG - Intergenic
1025319477 7:58079179-58079201 AAAAGGCAGGTCATCTTTGAAGG + Intergenic
1025477891 7:60949646-60949668 AAAAGGCAGGTCATCTTTGAAGG + Intergenic
1025483314 7:61013913-61013935 AAAAGGCAGGTCGTCTTTGAAGG + Intergenic
1025554238 7:62284296-62284318 AAAAGGCAGGTCATCTTTGAAGG - Intergenic
1025560543 7:62368978-62369000 AAAAGGCAGGTCATCTTTGAAGG + Intergenic
1025564628 7:62418284-62418306 AAAAGGCAGTTCATCTTTGAAGG + Intergenic
1025969015 7:66304682-66304704 ATACAGCATCTCCTCTTTGAGGG - Intronic
1027491440 7:78832610-78832632 ATTATGCAGGTCCTCCCTGACGG - Intronic
1027931541 7:84541865-84541887 GTAAGACAGGTGCTCTTTTAGGG + Intergenic
1027980106 7:85207257-85207279 ATAAAGCCTGTCCTCTTTTACGG - Intergenic
1029616434 7:101661265-101661287 AGAAGGCAGGTGCTTTTAGAAGG - Intergenic
1034718638 7:153266952-153266974 ATAAGGCAGGACATTTTTTAAGG + Intergenic
1034853624 7:154519543-154519565 AGTAGGCAGGTCCTCTTAGAGGG - Intronic
1036949681 8:13129220-13129242 TGAAGGCTGTTCCTCTTTGAAGG - Intronic
1042393075 8:68258104-68258126 ATAGGGCAGGTTTTCTTTGCAGG + Intergenic
1043319675 8:78968504-78968526 GTAAGGAAGGGCCTCCTTGAAGG + Intergenic
1043664349 8:82789450-82789472 ATAAAGCGGGTACTCCTTGAAGG + Intergenic
1044648171 8:94466861-94466883 ATAAGTAAGTACCTCTTTGAGGG - Intronic
1051521609 9:17995317-17995339 ATTAGGGAGGTATTCTTTGAAGG + Intergenic
1053539028 9:38954462-38954484 ATTAGACAGGGCCTCTTTGGAGG + Intergenic
1054627113 9:67409457-67409479 ATTAGACAGGGCCTCTTTGGAGG - Intergenic
1055488710 9:76782553-76782575 ATATGGCTGGGACTCTTTGAAGG - Intronic
1055567237 9:77581569-77581591 ATAAGGGAGGTCAACTTTCAAGG + Intronic
1060456210 9:123801016-123801038 ATAAGGAAGGCTCTGTTTGATGG - Intronic
1061207265 9:129172007-129172029 AGAAGGCAGTTCCTCTTGGGTGG + Intergenic
1203614677 Un_KI270749v1:48552-48574 AAAAGGCAGGTCATCTTTGAAGG + Intergenic
1186539647 X:10387610-10387632 ATAAAGCAGGTTTTCTTTAAAGG - Intergenic
1188813092 X:34677308-34677330 ATAAAACAAATCCTCTTTGAGGG - Intergenic
1189648666 X:43164123-43164145 ATAAGGTAGGACCTCTGAGAGGG - Intergenic
1191923945 X:66288263-66288285 ATTAGGAAGGTCCTCTTCCAAGG - Intergenic
1197981450 X:132221497-132221519 ATTAGCCAGCTCCCCTTTGAAGG + Intergenic