ID: 1154990586

View in Genome Browser
Species Human (GRCh38)
Location 18:21594764-21594786
Sequence TTGTTGTTATCACAAGACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154990586_1154990587 30 Left 1154990586 18:21594764-21594786 CCAGTGTCTTGTGATAACAACAA No data
Right 1154990587 18:21594817-21594839 CAGTAAATTTCAAATTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154990586 Original CRISPR TTGTTGTTATCACAAGACAC TGG (reversed) Intronic