ID: 1154991427

View in Genome Browser
Species Human (GRCh38)
Location 18:21601207-21601229
Sequence TAAAGAAGGAGGGTGGGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154991417_1154991427 3 Left 1154991417 18:21601181-21601203 CCTTTGGTCTTCCATATGAGCCA No data
Right 1154991427 18:21601207-21601229 TAAAGAAGGAGGGTGGGGCCGGG No data
1154991416_1154991427 10 Left 1154991416 18:21601174-21601196 CCAAGTGCCTTTGGTCTTCCATA No data
Right 1154991427 18:21601207-21601229 TAAAGAAGGAGGGTGGGGCCGGG No data
1154991418_1154991427 -8 Left 1154991418 18:21601192-21601214 CCATATGAGCCAATGTAAAGAAG No data
Right 1154991427 18:21601207-21601229 TAAAGAAGGAGGGTGGGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154991427 Original CRISPR TAAAGAAGGAGGGTGGGGCC GGG Intergenic
No off target data available for this crispr