ID: 1154997128

View in Genome Browser
Species Human (GRCh38)
Location 18:21651171-21651193
Sequence CTATTTCAATGTAAGTTATA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 290}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154997128 Original CRISPR CTATTTCAATGTAAGTTATA AGG (reversed) Exonic
903601302 1:24542965-24542987 GTATTTCAAAGTAAGTTACTTGG + Intergenic
906360173 1:45149810-45149832 TTGTTTCAACGTAATTTATAGGG - Intronic
906987415 1:50698734-50698756 TCATTGAAATGTAAGTTATAGGG - Intronic
908125955 1:61030525-61030547 CTATTTGAAAATAAGTGATATGG + Intronic
908371502 1:63484196-63484218 CTAATACAATGTAAGTGCTATGG - Intronic
909166017 1:72225940-72225962 CTATGTAAATATAAGTTATTAGG + Intronic
909538108 1:76760931-76760953 GTATTTCAATTTCAGTTATCAGG + Intergenic
910184460 1:84522348-84522370 CTATTTCATTTTATATTATAAGG + Intergenic
913027566 1:114860936-114860958 CTATTTTTATATAAGTAATAAGG + Intronic
913367558 1:118057899-118057921 ATATTTCAATGTTATTTAAAAGG + Intronic
913369360 1:118080990-118081012 TTATTTGAATTTAAGTTATTTGG - Intronic
914253627 1:145942700-145942722 ATCTTTTAATGTAAGTTGTATGG - Exonic
915398426 1:155604196-155604218 CTTTTTCAATAGAAGTTATACGG + Intergenic
915415861 1:155742318-155742340 CTTTTTCAATAGAAGTTATACGG + Intergenic
915482687 1:156197889-156197911 CTATTTTAACGAAAGTTATACGG + Intronic
918009199 1:180570918-180570940 CTTTTTGAATGAAAGTTACAGGG - Intergenic
918769207 1:188531920-188531942 ATATTTTAAAGTAAATTATAAGG - Intergenic
919059788 1:192617967-192617989 ATATTTTATTGTAAGCTATAAGG - Intergenic
919356602 1:196532313-196532335 CAATTTCCATGTAATTTATTTGG + Intronic
921628773 1:217408059-217408081 CTATTACAATGTTATTTTTAAGG + Intergenic
1065131609 10:22626684-22626706 ATATTTTAATGTAAAGTATAGGG + Intronic
1065436740 10:25710494-25710516 CTATTGAAATGTGAGTGATATGG - Intergenic
1065766266 10:29033001-29033023 CATTTTCAATGGAAATTATACGG - Intergenic
1066392516 10:34989516-34989538 TTATTTTAATGGAATTTATATGG - Intergenic
1067252471 10:44599138-44599160 TAATTTCTATGTAAGGTATAAGG - Intergenic
1067489337 10:46683670-46683692 CTATCTCAATTTAAGTCACACGG - Intergenic
1067605333 10:47656715-47656737 CTATCTCAATTTAAGTCACACGG + Intergenic
1068523166 10:58099923-58099945 CTATTTCAAGGTACTTTCTATGG + Intergenic
1069168346 10:65192618-65192640 ACATTTTAAAGTAAGTTATAAGG + Intergenic
1069623434 10:69851954-69851976 CTATTTCAATTTTAGTTTAATGG + Intronic
1070513677 10:77183786-77183808 CTATTTCTATTTAATTTTTAAGG + Intronic
1070513748 10:77184517-77184539 CTATTTCTATTTAATTTTTAAGG + Intronic
1072393187 10:95010504-95010526 CTATTTAAATGTAAATTCTAAGG - Intergenic
1072396232 10:95045111-95045133 CTATTTAAATGTAAATTCTAAGG + Intronic
1073879848 10:107968064-107968086 CAATTTGAATATAAGTTAGAGGG - Intergenic
1074280252 10:112044718-112044740 CTATTATACTTTAAGTTATAGGG - Intergenic
1074727963 10:116333990-116334012 ATATTTCAAGATAAGTTAAAAGG + Intronic
1075101210 10:119507431-119507453 CTTTTTCAACGTAAGTAAGAGGG - Intronic
1075182448 10:120224031-120224053 CTAATTCAATCTAATTTGTATGG - Intergenic
1078285841 11:9953830-9953852 CTATTTCTATGTTAGTGAGAAGG + Intronic
1078415960 11:11165026-11165048 CAATTTCAATGTGAGGTTTAGGG + Intergenic
1079001218 11:16758458-16758480 CTATTTTTATGTAAGATAGAAGG - Intergenic
1079895009 11:26107800-26107822 CTAGTTTAATGTAAGTTTTGGGG + Intergenic
1081286156 11:41272437-41272459 CTATTTCACTGCAAGTTTGATGG - Intronic
1081387324 11:42487041-42487063 CTATTCCAATGGAATTTAAATGG + Intergenic
1081830342 11:46105885-46105907 CTATTGCAGTATAAGTTATTGGG + Intronic
1085079212 11:73620291-73620313 CTATTTCAGTGAAATTTCTAGGG + Intergenic
1085920322 11:80947168-80947190 CTACTCCAATGTAAGTGATGAGG - Intergenic
1086163978 11:83755928-83755950 CTATTTGAGTGTAACTCATAAGG - Intronic
1087189754 11:95240986-95241008 CTATTTAAATGTGATTTATAGGG + Intergenic
1087997733 11:104831767-104831789 TTATTTCAATTTTAGTGATAAGG - Intergenic
1089483265 11:118824410-118824432 CTATTACAATGTTAATTAAAAGG + Intergenic
1090168737 11:124579476-124579498 TTATTTCAATAAAAGTTACATGG - Intergenic
1091967385 12:4756037-4756059 CTATTTCAGAGTAAGTCACATGG + Intronic
1091997364 12:5004205-5004227 TTATTTCACTTTAAGTTTTAGGG - Intergenic
1093574846 12:20715044-20715066 CTAGTTCAGTTTAAGATATACGG + Intronic
1093838563 12:23867440-23867462 CTATCTCAAAGTAAGAGATACGG + Intronic
1094396477 12:30011955-30011977 CCATTTCAAAGTAAAATATATGG + Intergenic
1094439064 12:30454830-30454852 CTTTTTCAAAGTTAGTTATACGG + Intergenic
1095601652 12:44020181-44020203 CTCTTTCAATGAAAATAATATGG + Intronic
1096881202 12:54673085-54673107 CTATTTTAAAGTTAGTTAAAAGG + Intergenic
1097259141 12:57704926-57704948 TTATCTTAATGTATGTTATAAGG + Intronic
1098578809 12:72074823-72074845 ATATTAGAATGTCAGTTATAAGG - Intronic
1098620622 12:72593527-72593549 TTATTTCACTTTAAGTTCTAGGG + Intronic
1098621472 12:72605866-72605888 GTAATTCAATGTAAGAAATATGG + Intronic
1099472228 12:83065281-83065303 CAATTTCAAAGTAAATTATGTGG - Intronic
1099561855 12:84188649-84188671 TAATTTCAATGTAAATTGTATGG - Intergenic
1100242550 12:92724326-92724348 CCATGTCAATGATAGTTATAAGG - Intronic
1100365128 12:93913309-93913331 CAATTTCAAAGTATGCTATAAGG + Intergenic
1100939682 12:99712525-99712547 GTATTTGAATGTATGTTATAAGG - Intronic
1101551832 12:105770469-105770491 CTATTTAAATGTGAGATGTATGG - Intergenic
1105202304 13:18190958-18190980 CTGTCTCAATTTTAGTTATAGGG + Intergenic
1109874948 13:68388807-68388829 ATATTTCAATGTAAGAAGTATGG - Intergenic
1111191740 13:84817387-84817409 GTGTTTCAATGTAACTCATAAGG + Intergenic
1112638469 13:101244753-101244775 GTATTTCAGTGTAGGTTATGGGG + Intronic
1112993668 13:105545645-105545667 CTTTTTGAATTTAAGTTATAAGG - Intergenic
1114361630 14:21980036-21980058 TTATTTCAGAGTAAGTAATAGGG - Intergenic
1115014883 14:28598852-28598874 ATATGTCAATGCAAGATATAAGG + Intergenic
1115672943 14:35636312-35636334 CTATTTCATTGTCAGTTTCATGG - Intronic
1117091800 14:52258668-52258690 GTATTTCAATGCAAGTTCCAAGG + Intergenic
1117282288 14:54253046-54253068 CTATTGCAATCTCTGTTATATGG + Intergenic
1117581158 14:57153031-57153053 ATATTTTACTGTAAGTGATAAGG - Intergenic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1118024955 14:61759614-61759636 TTATTTCTATGTATGGTATAAGG - Intergenic
1118054662 14:62067276-62067298 TTATTTTCATGGAAGTTATAGGG + Intronic
1118101893 14:62615123-62615145 CTATAAAAATTTAAGTTATATGG + Intergenic
1119957366 14:78813462-78813484 CTATTTCAATAGAAGTCATAGGG + Intronic
1120355579 14:83429093-83429115 CTATATCAAAGCTAGTTATAAGG + Intergenic
1120918132 14:89728296-89728318 CTATTTCAATGTCATTTACAAGG - Intergenic
1120929223 14:89831386-89831408 CAATTTCAATGTCACTAATAGGG + Intronic
1121182870 14:91942630-91942652 CTATTTTATTATAAGTTCTAGGG - Intronic
1124886286 15:33689350-33689372 TTTTTTAAATTTAAGTTATAGGG - Intronic
1127336284 15:57988159-57988181 CTATGTCTAAGTAAATTATAGGG + Intronic
1127611997 15:60646154-60646176 GTTTTCCACTGTAAGTTATAGGG + Intronic
1127731858 15:61809091-61809113 CTATTTCAATGAAAGAAAGAGGG - Intergenic
1129421292 15:75429096-75429118 CTATTTGTATTTAAGTTTTAGGG + Intronic
1137088024 16:36153362-36153384 TTATTACAATTTAAGTTTTAGGG + Intergenic
1138764367 16:59583726-59583748 CTATTGGAATGTAAATTATATGG + Intergenic
1140580289 16:76223508-76223530 CTATTTCAGTGTTTGTCATAAGG - Intergenic
1144239073 17:13292027-13292049 ATATTTTAAAATAAGTTATATGG + Intergenic
1144406225 17:14955102-14955124 CTATTTTTATTTAAGTAATATGG + Intergenic
1147783027 17:42957431-42957453 CCATGGCAATGTAACTTATAAGG + Intronic
1148037392 17:44677309-44677331 CTAGTGGAATATAAGTTATAGGG + Intronic
1149930251 17:60745226-60745248 TAATTTCAATGTAAGTTCTATGG + Intronic
1153393125 18:4585936-4585958 CTATTTTCTTGTAAGTAATATGG - Intergenic
1154997128 18:21651171-21651193 CTATTTCAATGTAAGTTATAAGG - Exonic
1156115502 18:33782260-33782282 ATATTTCAATTTAATTTATTTGG + Intergenic
1156842144 18:41621665-41621687 CTATTTCTATGTCAGTGATGCGG + Intergenic
1157459537 18:47875692-47875714 CTCTTTCAATTTTATTTATAAGG + Intronic
1157870294 18:51224104-51224126 CTCTTGAAATGTAAGATATAGGG - Intergenic
1158127173 18:54113785-54113807 AAATTTCAGTGTCAGTTATAGGG - Intergenic
1159283310 18:66315358-66315380 CTATTTCAGTGAAAATTAAAGGG + Intergenic
1163067659 19:14810916-14810938 ATATTTCTATGTATGTTATTTGG + Intronic
1164786746 19:30937668-30937690 CTATTATAATTTAAGTTTTAGGG + Intergenic
1165178088 19:33944774-33944796 CTCTTTCAATGGAAGTTTTGGGG - Intergenic
1168214334 19:54914222-54914244 TTTTTTTAATGTAAGTTTTAGGG + Intronic
925436272 2:3840608-3840630 GTATTTTAATGTAAGATGTATGG - Intronic
928743614 2:34385863-34385885 CAATTTCAATGGAAGATATCAGG + Intergenic
929991714 2:46795611-46795633 CTAATACAATGTAAGTGGTATGG + Intergenic
930150336 2:48052894-48052916 TTATTTTACTTTAAGTTATAGGG + Intergenic
930961755 2:57270872-57270894 TTATTTTACTTTAAGTTATAGGG + Intergenic
932784271 2:74586255-74586277 CCATTTAAATGTAAATTAAAAGG + Intronic
933015284 2:77116149-77116171 CTACTTAAATGAAAGGTATAAGG - Intronic
936472579 2:112811999-112812021 CTCTTTCAATGAAAGTTTAAAGG + Intergenic
936841230 2:116771955-116771977 CAATTTCAGTGTAAGTTTTGAGG + Intergenic
939334794 2:140812320-140812342 CTATTTCAATTTTTATTATAGGG - Intronic
939564720 2:143773470-143773492 ATATTTGAATCTAAGTAATATGG + Intergenic
939578272 2:143921197-143921219 ATATTTGAATGTATGTTATTTGG + Intergenic
940114024 2:150187995-150188017 CTATTTCACTGGAATTTATGGGG + Intergenic
940329044 2:152454960-152454982 CTACTTCAAAGTAAGGTATCAGG - Intronic
940539008 2:154986615-154986637 TAATTTCAATGTATATTATAAGG + Intergenic
940603401 2:155889040-155889062 GTATTTCAATATAAAGTATAAGG + Intergenic
941444180 2:165580602-165580624 CTATTTTAATGTACTTTATGGGG + Intronic
941763529 2:169270734-169270756 CTATTTTACTTTAAGTTCTAGGG - Intronic
941763579 2:169271493-169271515 CTATTTTACTTTAAGTTCTAGGG - Intronic
942361558 2:175178006-175178028 ATATTCCAATGTAATTTTTATGG - Exonic
942471684 2:176267599-176267621 TTATGTCAATGTAAATTATTGGG + Intergenic
942801948 2:179885614-179885636 ATATAGCAATGTAATTTATATGG - Intergenic
944755548 2:202757951-202757973 CTATTTCCAAGTAACTTCTAAGG - Intronic
945354364 2:208820729-208820751 ATGTTTCAATGTAAGGTACAAGG + Intronic
945827696 2:214744514-214744536 CTATTTCAATGAAAAGTAAATGG - Intronic
946811919 2:223534813-223534835 CTATTTTAAAGTAATTTAGAGGG + Intergenic
1170193531 20:13667420-13667442 ATTTTTTAATGTAAGTTTTATGG + Intergenic
1170391147 20:15876126-15876148 TTATTACACTGTAAGTTCTAGGG + Intronic
1170807979 20:19650371-19650393 CTATTTTTATTAAAGTTATATGG + Intronic
1172822017 20:37744932-37744954 CTGTTTCAGTGTATGATATAAGG - Intronic
1173296790 20:41766802-41766824 TTATTTCACTTTAAGTTCTAGGG - Intergenic
1173323736 20:42013505-42013527 CTATTTTTTTGTAAGTTGTAGGG + Intergenic
1176715647 21:10347050-10347072 CTGTCTCAATTTTAGTTATAGGG - Intergenic
1179145066 21:38760848-38760870 CTATTTCGATGAAAGTTCTTCGG + Intergenic
1180602698 22:17032903-17032925 CTGTCTCAATTTTAGTTATAGGG + Intergenic
1182705434 22:32275235-32275257 TTATTACACTGTAAGTTTTAGGG + Intergenic
1184318237 22:43716141-43716163 CAATTTAAATGTAAGTAATGTGG - Intronic
949215546 3:1562737-1562759 CGATATAAATGTAAGTTATAAGG - Intergenic
949256993 3:2060457-2060479 TTATTTTAATTTAAGTTTTAGGG + Intergenic
951451992 3:22850517-22850539 CTATTTTACTTTAAGTTTTAGGG - Intergenic
952019420 3:28999034-28999056 CTATTTTACTTTAAGTTCTAGGG - Intergenic
955099964 3:55837733-55837755 TTATTACACTTTAAGTTATAGGG - Intronic
956798591 3:72737658-72737680 CTAATACAATGTAAGTGCTATGG + Intergenic
957299576 3:78374499-78374521 CTATTTCTGTGTAAGAAATAAGG - Intergenic
957848681 3:85776702-85776724 ATATTTCAATATAAGTGTTAAGG + Intronic
958121265 3:89292305-89292327 CTAATACAATGTAAATGATATGG - Intronic
958269129 3:91476876-91476898 TTATTTCTATGTAAATAATATGG + Intergenic
958760677 3:98304107-98304129 CTATTTCAGTGAAATTTCTAGGG - Intergenic
959392118 3:105788626-105788648 CTTTTACAATGTATGTTTTAGGG - Intronic
959486951 3:106937804-106937826 CTAATTCTATGTAAGTTCAAAGG - Intergenic
959626728 3:108460724-108460746 ATCTTTCCATATAAGTTATATGG - Intronic
960772336 3:121208462-121208484 CTATTACACTTTAAGTTCTAGGG - Intronic
960796152 3:121490745-121490767 GTTTTTCAATGAAAGTTTTATGG - Intronic
961228505 3:125277520-125277542 CTATTTCAAAGTAATTTCTTGGG + Intronic
962890842 3:139671665-139671687 CTTCTTCTATGTAACTTATATGG - Intronic
962915284 3:139895989-139896011 TCAGTTCAATGTAAGATATATGG - Intergenic
964139673 3:153382612-153382634 CTATTATAATGTAAGATAAATGG - Intergenic
964384553 3:156133474-156133496 CTATTTCAATGTTACATATATGG - Intronic
964869237 3:161295004-161295026 CAATTTCAATGTTAGTAATTTGG - Intergenic
966791715 3:183677632-183677654 CTATTTCATTGTTGGTTATGTGG + Intronic
967763598 3:193252376-193252398 CAATTAGAATGTAGGTTATATGG - Intronic
967935342 3:194723210-194723232 TTATTTTAATGTGCGTTATATGG + Intergenic
970710326 4:18854483-18854505 CTCTTTCTATAAAAGTTATATGG + Intergenic
972943799 4:44228738-44228760 CTGTTTTAATGGAGGTTATAAGG - Intronic
973098002 4:46226333-46226355 CTATTTCAGTGAAATTTCTAGGG + Intergenic
973671424 4:53222540-53222562 CTATTTTAATGACAGTTCTAGGG + Intronic
974313344 4:60242836-60242858 CTATTTTATTATAAGATATAAGG + Intergenic
974422904 4:61701303-61701325 CTATCTCAAAGTAGGTTATATGG + Intronic
976540413 4:86267930-86267952 CTATTACAATGTAAATTATTTGG + Intronic
976589277 4:86832975-86832997 CTTTTTCAAAGTAAATTATCTGG + Intronic
976782923 4:88781520-88781542 CTCTTTCAATGTGATTTATTTGG - Intronic
976958179 4:90931515-90931537 CTATTTCATTAGAAGGTATATGG - Intronic
977453700 4:97230193-97230215 ATATTTCACTTTAACTTATAAGG - Intronic
977754576 4:100652474-100652496 CTATTTAAATGAAAATTAGAAGG + Intronic
977974631 4:103250277-103250299 TTATTTCACTTTAAGTTTTAGGG + Intergenic
979043068 4:115824385-115824407 CTATTTACATATAATTTATATGG - Intergenic
979269027 4:118737614-118737636 CTATGTCAATAAAAGTTAGATGG - Intronic
979718100 4:123866178-123866200 ATATCTCAATGTGAGTTACAGGG + Intergenic
979979430 4:127236415-127236437 CTATTTTAATGTGAGTTATAGGG + Intergenic
980115062 4:128671585-128671607 CTATTTCAAAGTAATATAGAAGG - Intergenic
980176266 4:129348695-129348717 CTATTTAAATGTAAGAAATTTGG - Intergenic
980260025 4:130436832-130436854 TTATTACACTTTAAGTTATAGGG + Intergenic
982114229 4:152083771-152083793 CTATTCCAGTGTAAGTTATTAGG - Intergenic
983118720 4:163852779-163852801 CTATTTCTATGTAACTGCTAAGG + Intronic
983559290 4:169085078-169085100 CTTTTGCGATGTAATTTATAAGG + Intergenic
984210651 4:176843401-176843423 CTTTTTCATAGTAAATTATAAGG - Intergenic
987217420 5:15751578-15751600 CTATTTGTGTGTAAGTTGTATGG - Intronic
987501542 5:18716371-18716393 TTATTTTAATGTAAGTAATAAGG - Intergenic
988049350 5:26004842-26004864 ATATTTTAATGTATTTTATAAGG + Intergenic
988859778 5:35265583-35265605 CTATTGCTATGTTATTTATAAGG - Intergenic
989124975 5:38044151-38044173 CTATTGCAATCTAGGTTAAAAGG + Intergenic
990087182 5:51993283-51993305 CTATTTTAATCTAAGTTGCAAGG + Intergenic
990782671 5:59383581-59383603 CTATTTCTGTGTAGCTTATATGG - Intronic
991380098 5:66012118-66012140 CTATTTCCAAGTAAGTTCTCAGG + Exonic
991473771 5:66998512-66998534 CTATTTCAATTTCAGTTTCATGG - Intronic
992662070 5:78971538-78971560 CTATTCCACTTTAAATTATAAGG - Intronic
993088745 5:83397469-83397491 CTAATTCAATGTAAATGCTATGG + Intergenic
993280486 5:85919708-85919730 ATTTTTAAATGTAAGTGATATGG - Intergenic
996364706 5:122688771-122688793 CTATTATAATCTAAGTTACATGG + Intergenic
999437181 5:151571855-151571877 CTATTTTAATCTAAGTGCTATGG - Intergenic
1000736923 5:164915020-164915042 ATCTTCCAATGTAAATTATAAGG + Intergenic
1001627988 5:173152648-173152670 CTATTAGAATGTAAATTCTATGG - Intronic
1004559651 6:16735697-16735719 CTTTGTCAATGTAAGATATTAGG - Intronic
1008353868 6:50527766-50527788 ATATTTCAAAGTAAAGTATAAGG - Intergenic
1008986096 6:57544864-57544886 TTATTTCTATGTAAATAATATGG - Intronic
1009166136 6:60344043-60344065 CTATATCAATCTTAGTTATAAGG - Intergenic
1009174053 6:60437415-60437437 TTATTTCTATGTAAATAATATGG - Intergenic
1009567598 6:65330840-65330862 CTACTTCTATATAAGGTATAAGG + Intronic
1010596359 6:77768863-77768885 CTAATTGAATATAAGTTATATGG + Intronic
1010736956 6:79453829-79453851 ACATTTCAATCTAAGTTCTAGGG - Intergenic
1011037644 6:82995418-82995440 TAATTTAAAAGTAAGTTATAGGG + Intronic
1011080241 6:83482289-83482311 CTTTTTGAAGGTATGTTATAAGG - Intergenic
1011403960 6:86996462-86996484 ATTTTTCTATGTCAGTTATAAGG - Intronic
1012032916 6:94095930-94095952 CTATTTCAAATTAAATAATAAGG + Intergenic
1012556207 6:100515615-100515637 AGCTTTCTATGTAAGTTATATGG + Intronic
1013020969 6:106217717-106217739 CTATTTCACTATTACTTATATGG + Intronic
1013171377 6:107639310-107639332 CTAGTTCTTTGTAAATTATAGGG + Intronic
1014855755 6:126398565-126398587 CTAATACAATGTAAATTCTATGG + Intergenic
1015398677 6:132763896-132763918 TTTTCTCACTGTAAGTTATAAGG + Intergenic
1015822138 6:137273956-137273978 CTATTACAATATAAATTGTACGG - Intergenic
1016017522 6:139201093-139201115 TTATTTCAATGTAAAGTAAAAGG - Intergenic
1016545346 6:145216456-145216478 CTTTTTCAATATATGTTTTAAGG - Intergenic
1016740477 6:147523182-147523204 CCATTTCAATTTATTTTATAAGG - Intronic
1017479931 6:154842676-154842698 AGATTTCTATATAAGTTATAGGG - Intronic
1018713921 6:166517126-166517148 TTATTTTAGTGTAAGATATAGGG - Intronic
1021197872 7:17692543-17692565 CTCCCACAATGTAAGTTATAAGG + Intergenic
1022814700 7:33903730-33903752 CTCTTTCAATTTAAATTTTACGG + Intergenic
1023218443 7:37892113-37892135 TTGTTTCATTGTAAGTAATATGG + Intronic
1023323068 7:39021217-39021239 CTATTTCAATTTATGTTATGTGG + Intronic
1023383364 7:39630674-39630696 TTATTTCTATGTATGATATAAGG + Intronic
1024145192 7:46507954-46507976 CTTTTTAAATGTAACTTATTTGG + Intergenic
1027565869 7:79793201-79793223 CTATTTCCATGTAAGTCACAAGG - Intergenic
1028698480 7:93746150-93746172 CTATTACACTTTAAGTTTTAGGG - Intronic
1028739507 7:94257529-94257551 CATTTTCAGTGTAAGTTAAAAGG - Intergenic
1028981546 7:96972682-96972704 GTATTTCAAGGTATGCTATATGG - Intergenic
1030124013 7:106137650-106137672 TTATTTAAATGTAAGTTTTATGG - Intergenic
1030169339 7:106585890-106585912 CTATTTGAAAGTGAGTTAGAAGG - Intergenic
1031218560 7:118931121-118931143 CTGTTTCAATGTAGGTTTCATGG + Intergenic
1031277809 7:119753117-119753139 GTATTTCTTTGTAAGTTTTATGG - Intergenic
1032008354 7:128322951-128322973 CTTTTTGAAAGTAAGTTATATGG + Intronic
1033201140 7:139371275-139371297 CTATTTCACTGTACATTATCAGG - Intronic
1033508036 7:142025420-142025442 CTATCTCAGAGTAAATTATAGGG - Intronic
1035520056 8:268382-268404 CTATTCCTTTGTAAATTATAGGG + Intergenic
1039165373 8:34673528-34673550 CTATTACAATATAATTTTTATGG - Intergenic
1041248617 8:55913212-55913234 ATATTTCAATGTGAATTATTTGG - Intronic
1041401799 8:57453818-57453840 ATAATTAAATGTAAGGTATAAGG + Intergenic
1043002224 8:74773014-74773036 CTGTTTCAAGGTAAGTTGTGTGG - Intronic
1047469033 8:125149192-125149214 ATATCTCAATGTAAGTTAGGGGG - Intronic
1048749081 8:137650485-137650507 ATATTTAAATATATGTTATATGG - Intergenic
1050002120 9:1088328-1088350 ATTGTTTAATGTAAGTTATAAGG + Intergenic
1050282096 9:4061077-4061099 CTATTACACTTTAAGTTCTAGGG + Intronic
1050522576 9:6517030-6517052 CTATTTAAATCTATTTTATAAGG + Intergenic
1050627105 9:7516699-7516721 CTATTAAAATGTAATTTATTTGG - Intergenic
1050653926 9:7803594-7803616 CTATTTATATATATGTTATATGG + Intronic
1051514339 9:17911696-17911718 CTATTATAATATAAGTTTTAGGG + Intergenic
1051977879 9:22975189-22975211 ATTTTTCATTGTAAATTATATGG - Intergenic
1052206348 9:25845751-25845773 CTATTTCAATATAAGTCACCTGG - Intergenic
1052453730 9:28666546-28666568 CTAGTTCAAGGTCAGTTAAATGG + Intronic
1052565284 9:30141973-30141995 CAATTTCAATGTAAGCTAACTGG + Intergenic
1053616067 9:39767163-39767185 TTATTACAATGTATGTTTTAAGG + Intergenic
1053898379 9:42768110-42768132 TTATTACAATGTATGTTTTAAGG - Intergenic
1054237450 9:62575227-62575249 TTATTACAATGTATGTTTTAAGG - Intergenic
1054551585 9:66609738-66609760 TTATTACAATGTATGTTTTAAGG - Intergenic
1056014217 9:82365781-82365803 CCATTTCAATCTAAGTCATGGGG + Intergenic
1056219654 9:84438434-84438456 CTATTTCAAGGTATTTTTTATGG - Intergenic
1057310165 9:93937917-93937939 CTCTTTCATTGTAACTTATCTGG - Intergenic
1057534713 9:95888980-95889002 CTATTTCAACTTAAGTTTTTCGG + Intronic
1203629661 Un_KI270750v1:60263-60285 CTTTTTTAATGTAAGATATGAGG + Intergenic
1186690656 X:11971878-11971900 CTCTTACAATGGAAGTGATATGG + Intergenic
1186867628 X:13735952-13735974 CTTTTTTAATTTAAATTATATGG + Intronic
1187026544 X:15441241-15441263 TTATTTTAATGTGATTTATAAGG + Intronic
1187574442 X:20539762-20539784 CTATATCAAGGGAAGATATAGGG - Intergenic
1187580087 X:20598051-20598073 CTATTTCAATTTGTGTTATCAGG + Intergenic
1188996698 X:36895100-36895122 CTACTTCAATGTAATTCAAAGGG - Intergenic
1189136553 X:38556596-38556618 CTACTAAAATGTAAGTTCTACGG - Intronic
1189573201 X:42321564-42321586 CTAATTCAATTTACGTTATTAGG + Intergenic
1190526587 X:51334151-51334173 CTATTTCTATGTAGGTCATTTGG + Intronic
1190796179 X:53745165-53745187 TTATTTCTGTGTAAGATATAAGG + Intergenic
1191018382 X:55834887-55834909 TTATTACACTGTAAGTTTTAGGG - Intergenic
1191613663 X:63144551-63144573 ATATTTAAATCTATGTTATAGGG - Intergenic
1191622634 X:63234376-63234398 ATATTTAAATCTATGTTATAGGG + Intergenic
1191914713 X:66189021-66189043 CTTTTTCAATTTAATTAATATGG - Intronic
1194092650 X:89598174-89598196 CTATTTCTATATACATTATAGGG + Intergenic
1194786159 X:98086523-98086545 CTATTTCTATGTGATTGATATGG - Intergenic
1194917927 X:99727229-99727251 TGATTTCAAAGTAAGCTATAAGG - Intergenic
1195868598 X:109461486-109461508 CTATTTCATTGAAAGTTATTGGG + Intronic
1196383844 X:115125673-115125695 ATATATCAATGTAAATTATTTGG + Intronic
1197017005 X:121636664-121636686 CTATCTCAGTGAAATTTATAGGG + Intergenic
1197518744 X:127471833-127471855 TTTTTTCAAGGTAAGTTACATGG - Intergenic
1197703716 X:129618676-129618698 CTATTTCCATGTCTGTTAAAAGG + Intergenic
1199212820 X:145233759-145233781 CAAATTCAATGTATGTTTTATGG - Intergenic
1199929180 X:152501236-152501258 CTGTTTCAATGTAAGCAAAATGG - Intergenic
1200445295 Y:3254277-3254299 CTATTTCTATATACATTATAGGG + Intergenic
1200698482 Y:6382059-6382081 CTAATTCAATGTAAATTCAAGGG + Intergenic
1200881906 Y:8223127-8223149 TAATTTCTATGTAAGGTATAAGG - Intergenic
1200935650 Y:8736004-8736026 CTAATTCAAGGTAAATTACAGGG + Intergenic
1201035632 Y:9782640-9782662 CTAATTCAATGTAAATTCAAGGG - Intergenic
1201529713 Y:14978369-14978391 CTATTTCAATAAAATTTCTAGGG - Intergenic
1201573694 Y:15439861-15439883 TTATTACACTTTAAGTTATAGGG - Intergenic
1201582277 Y:15522596-15522618 TTATTACACTTTAAGTTATAGGG + Intergenic
1201788472 Y:17810465-17810487 CTTTTTAAATTTAAATTATATGG + Intergenic
1201813081 Y:18095523-18095545 CTTTTTAAATTTAAATTATATGG - Intergenic
1201850164 Y:18471482-18471504 CTTTTTAAATATAAGTTATATGG - Intergenic
1201883154 Y:18848895-18848917 CTTTTTAAATATAAGTTATATGG + Intergenic