ID: 1154999428

View in Genome Browser
Species Human (GRCh38)
Location 18:21672261-21672283
Sequence ATCTCCTCCAAGAATAGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154999428_1154999430 -2 Left 1154999428 18:21672261-21672283 CCCTAGCTATTCTTGGAGGAGAT 0: 1
1: 0
2: 1
3: 7
4: 125
Right 1154999430 18:21672282-21672304 ATTAATTTGCTACTCTGCAGTGG 0: 1
1: 0
2: 0
3: 6
4: 164
1154999428_1154999432 29 Left 1154999428 18:21672261-21672283 CCCTAGCTATTCTTGGAGGAGAT 0: 1
1: 0
2: 1
3: 7
4: 125
Right 1154999432 18:21672313-21672335 ACTCAGAATCCTTCTCTTTCAGG 0: 1
1: 0
2: 0
3: 20
4: 234
1154999428_1154999433 30 Left 1154999428 18:21672261-21672283 CCCTAGCTATTCTTGGAGGAGAT 0: 1
1: 0
2: 1
3: 7
4: 125
Right 1154999433 18:21672314-21672336 CTCAGAATCCTTCTCTTTCAGGG 0: 1
1: 0
2: 0
3: 27
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154999428 Original CRISPR ATCTCCTCCAAGAATAGCTA GGG (reversed) Intronic
901472586 1:9468007-9468029 ATATCCTGCAAGAATAGAGAGGG + Intergenic
903806315 1:26008089-26008111 ATCACATCTATGAATAGCTATGG + Intergenic
904059073 1:27693591-27693613 AACTCTTCCCAGCATAGCTAGGG + Intergenic
906540582 1:46582889-46582911 AGCCCCTCCAGGAATAGCTGAGG + Intronic
906988766 1:50714687-50714709 ATATCCCCCAAGAATGGCTTGGG + Intronic
907327023 1:53644937-53644959 ATCTCCTCCACAAAAATCTAAGG + Intronic
908773760 1:67619780-67619802 ATCTCCTCCAAGAAGCCCTTTGG - Intergenic
912587710 1:110781593-110781615 ATCTCCTGTAATAATAGTTATGG - Intergenic
915917535 1:159949996-159950018 ATCTCCTGCACAAATACCTAGGG + Intergenic
916616187 1:166443355-166443377 CTGTCCTCCAAGAAATGCTAAGG - Intergenic
920519355 1:206612195-206612217 ATGTCGGCCAAGAATAGCGAGGG + Intronic
1062978952 10:1705895-1705917 TTCTGATCCTAGAATAGCTAGGG - Intronic
1063876894 10:10488994-10489016 ATTTCCTCCAAGCAAGGCTATGG + Intergenic
1065864183 10:29899288-29899310 AGCTGCTCCCAGAATAGCGAAGG + Intergenic
1067188062 10:44046857-44046879 AGCTCCTCAAAGAATGGCAAAGG + Intergenic
1067942814 10:50670299-50670321 ACCTTCTCCAAGAGCAGCTAAGG + Intergenic
1070864058 10:79695263-79695285 ACCTTCTCCAAGAGCAGCTAAGG + Intergenic
1071630955 10:87217489-87217511 ACCTTCTCCAAGAGCAGCTAAGG + Intergenic
1073142165 10:101255289-101255311 ACCTCCTCCAAGGTTAGCGATGG - Intergenic
1073823836 10:107296690-107296712 ATTTCCACCAAAAATACCTAAGG - Intergenic
1074040144 10:109780332-109780354 AACCCCTCCAGGAATAGCCAGGG - Intergenic
1074071462 10:110073931-110073953 ATCTACTACAAGACTGGCTAAGG - Intronic
1083482326 11:62957492-62957514 ATCCCCTCCATGCATAGTTATGG - Intronic
1085303867 11:75474146-75474168 ATTTCCTCCAGGAAGAGCAAGGG - Intronic
1089791516 11:120948313-120948335 ATCCCCTCCCAGCATAGCCAAGG - Intronic
1091789135 12:3261322-3261344 ATCTCCTCCAAAAATGCATACGG - Intronic
1098377260 12:69830171-69830193 ACCTCCTCCAGGAATAGGTCTGG + Intronic
1099771392 12:87062865-87062887 AAATCCTCTAAGAATATCTATGG - Intergenic
1102316425 12:111891453-111891475 ATCTCCTCCAAGAATGGGAATGG - Intronic
1105870655 13:24503334-24503356 TTCTCCTTCAAGAATAGATATGG + Intronic
1106655458 13:31740786-31740808 ATCTCTTACATGAAAAGCTAAGG + Intronic
1109596565 13:64563462-64563484 ATCTCCTTCAATAATTGCTCTGG + Intergenic
1113591581 13:111505195-111505217 ATCTCCTCCAACAATCCCGAGGG + Intergenic
1113728519 13:112623562-112623584 GCCTCCTCCAGGAATAGCTCAGG + Intergenic
1116873847 14:50092293-50092315 ATCTCATCCAGGATCAGCTAGGG + Intronic
1117458722 14:55923638-55923660 ATTTCTCCCACGAATAGCTATGG + Intergenic
1120120490 14:80673739-80673761 ATCTCCTTCAAGAAAACCAAAGG - Intronic
1120699728 14:87685808-87685830 ATCTCCTCCAAATAAAGCAAAGG + Intergenic
1121779892 14:96615618-96615640 CTGTGCTCCAAGAATAGCCAAGG + Intergenic
1124024773 15:25955231-25955253 ATGCCCTCCAAGAAAAGCTCTGG - Intergenic
1126184044 15:45813311-45813333 ATGTCCTGCAAGAAATGCTAAGG + Intergenic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1127530306 15:59837251-59837273 TTTTCCTCCAAGAATAGCCTTGG - Intergenic
1129895522 15:79102836-79102858 CTCTCCTCGAAGAATGCCTAGGG + Intergenic
1130446301 15:84004972-84004994 TTCTCCTCCAAGAACAGGAAAGG + Intronic
1130834700 15:87638455-87638477 AGCACCTCAAAGTATAGCTAAGG - Intergenic
1132001926 15:98189215-98189237 TTCTCCTCCAAGATTACCCAAGG + Intergenic
1134297965 16:12963321-12963343 TTTTCCTCCAAGAAAAGCTGGGG + Intronic
1138662169 16:58527755-58527777 CAATCCTCCAAGAATAGCAAGGG + Intronic
1141062061 16:80882802-80882824 AGCTCCTCCAGGATTAGGTAGGG + Intergenic
1142916568 17:3144404-3144426 ATCTCTTCCAAAAATAGAAAAGG - Intergenic
1143597840 17:7925971-7925993 ATCTCCTGGAAGAATAGAAATGG + Exonic
1144633718 17:16889753-16889775 ATCTCCACCAAGAAGACCCAGGG - Intergenic
1149211588 17:54308881-54308903 GTCTTTTCCAAAAATAGCTAAGG - Intergenic
1149354266 17:55823873-55823895 ATCTCCATCAGGAATAGCTCAGG - Intronic
1151087735 17:71400299-71400321 ATATTATCCAAGAATAGTTAAGG + Intergenic
1153950398 18:10053430-10053452 AGCTCCTTCAAGAATAGGCAAGG + Intergenic
1154999428 18:21672261-21672283 ATCTCCTCCAAGAATAGCTAGGG - Intronic
1155089727 18:22494750-22494772 ATATCCTACATGAATAGCTTTGG - Intergenic
1155491585 18:26406204-26406226 ATCCCTTCCAAGTATAGCCATGG + Intergenic
1156685813 18:39644119-39644141 ATCTCCTCCAACATTTGGTAGGG + Intergenic
1158801270 18:60912996-60913018 CTCTGCTCCAATAGTAGCTATGG + Intergenic
1159685683 18:71416920-71416942 ATCTCCCCCAATACTAGCCAAGG - Intergenic
1159787998 18:72738275-72738297 ATCTACTCCAAGTAAAGTTACGG - Intergenic
1165855660 19:38878226-38878248 CTCTCCTCCGAGAACAGGTAGGG - Exonic
1166801588 19:45460985-45461007 ATCTCCTCCAGGAAGCCCTAGGG + Intronic
925904308 2:8530226-8530248 CTTTCCTCCAAAAATAGCCAGGG + Intergenic
926226120 2:10968084-10968106 AACTGCTCTAAGAATAACTAGGG + Intergenic
935514538 2:104020179-104020201 ATCTCCTCCAAAAATAGTGCTGG - Intergenic
937063053 2:118994446-118994468 AGCTGCACCAAGAATAGCTGGGG + Exonic
938049598 2:128156394-128156416 ATGTCCTCCAAGGAAATCTATGG + Exonic
938794353 2:134705675-134705697 GTCTTGTCCAAGAAGAGCTACGG + Intronic
940689412 2:156896637-156896659 ATCTCCTCTAGAAAAAGCTAGGG + Intergenic
944013859 2:195008349-195008371 ATGTCCTGCAAGAATAGGAAAGG - Intergenic
944478666 2:200132566-200132588 TTCTCCTTGAAGACTAGCTAAGG + Intergenic
944986155 2:205179776-205179798 ATCTCTGCAAAGAATAGCAAAGG + Intronic
945802372 2:214449584-214449606 AAATCCTCCAAGAATTGCTGTGG + Intronic
946503807 2:220277553-220277575 CTCTCCTCCAAGACAAGCCAGGG - Intergenic
1168818654 20:758531-758553 ATGTCCTCAAATAATAACTAGGG - Intergenic
1170170556 20:13406405-13406427 ATGTCCTCTGAGAATAACTATGG + Intronic
1170668631 20:18408702-18408724 ATCTTCCCAAAGAAAAGCTAAGG + Intronic
1172358947 20:34298959-34298981 GTCACCTCCAAGGATAGGTAAGG - Intronic
1174921291 20:54705155-54705177 ATCTCCTCCTAGTATATCCAAGG + Intergenic
1177862060 21:26465621-26465643 ATCTCCTCCAGGAGAAACTATGG - Intergenic
1181426591 22:22847469-22847491 ATCTCTTCCAAAAATAGATGAGG + Intronic
1184558847 22:45249572-45249594 ACCTTCTCCAAGATTAGCAAAGG + Intergenic
954885801 3:53872359-53872381 TTCTCCTACCAGAATTGCTACGG + Intronic
955070570 3:55569290-55569312 AACTCCTCCAAGATTATCTTGGG + Intronic
956554141 3:70498959-70498981 CTCTCCTCCAATGAGAGCTAGGG - Intergenic
959066325 3:101660879-101660901 ATCTCCTCCCAGTACAGCTGGGG - Intronic
962986182 3:140538111-140538133 ATCTCCACCAAGAATAGATGAGG - Intronic
966242578 3:177770933-177770955 TGCTCCTCTAAGAATAACTAAGG + Intergenic
966301313 3:178482536-178482558 ATCTCTTCTAAGAGTAGATATGG - Intronic
967114975 3:186328893-186328915 ATTTCCTTCAAGAAAAGTTAGGG + Intronic
971714443 4:30157524-30157546 ATTTCCTCCAAGAAAAGTTATGG - Intergenic
974431053 4:61796392-61796414 ATCTCCACCAAGACTTACTATGG - Intronic
981545942 4:145893195-145893217 ACCTCCTCCAAATAAAGCTAAGG + Intronic
983884751 4:172967848-172967870 ATATCCTCCAAGAATAACGGGGG + Intronic
986771161 5:10975175-10975197 AGCTCTTCAAAGAATAGCAAAGG - Intronic
992234092 5:74690846-74690868 TTCTCTTCTAAGAACAGCTATGG - Intronic
995260351 5:110096744-110096766 ATCTCCTCCAGGAGTAGGTTTGG + Intergenic
998783671 5:145685893-145685915 ATCTCCTCCAAGATTTTCTGAGG + Intronic
1007295137 6:40815642-40815664 ATATGCTCCAGGAATAGCCAAGG + Intergenic
1008730691 6:54479339-54479361 ATCACCTCCAATAATAGGTTGGG + Intergenic
1008954881 6:57203752-57203774 ATCTACTCCAAGAACGGCTTGGG + Intronic
1009636616 6:66273901-66273923 ATATCCTCCATGAATATATATGG + Intergenic
1014774363 6:125491472-125491494 ATATACTCAAAGAATAGCAAAGG + Intergenic
1015065392 6:129020250-129020272 CTCTCCTCCAGGAATAAGTATGG - Intronic
1022451090 7:30515855-30515877 ATCTCATTCCAGTATAGCTATGG - Intronic
1026558476 7:71428416-71428438 ATGTCCACCAAGAAAAGCAATGG - Intronic
1027489787 7:78808756-78808778 ATCTCCCCCACCAATAGCAAAGG - Intronic
1027809026 7:82868583-82868605 ATTTCCTCACAGAATACCTATGG + Intronic
1028326547 7:89533891-89533913 ATCTCATCTGAGAGTAGCTAGGG + Intergenic
1030076147 7:105738780-105738802 AGCTCCTCCAAGAAAGGCTGTGG + Intronic
1030446549 7:109652518-109652540 ATCTCCTCCAAAAAATGCTGAGG + Intergenic
1032417392 7:131746841-131746863 ATCTCCTTCAAAAAAAGATATGG - Intergenic
1035363219 7:158327961-158327983 CCCTCCTCCAAAAATAGCTGGGG - Intronic
1036814761 8:11893564-11893586 CTGTCCTCCAAGAAATGCTAAGG - Intergenic
1038341699 8:26691635-26691657 ATCTGCTCCAACAATAGTAAAGG + Intergenic
1040013401 8:42680962-42680984 ATCTCCTCAAAGCATAGGTCAGG + Intergenic
1041210036 8:55540497-55540519 TTCTCATCCAAGAATAGCTATGG - Exonic
1042588140 8:70365560-70365582 TTCTCCTGAAAGAATACCTATGG - Intronic
1042704620 8:71653055-71653077 ATATCTACCAAGAACAGCTATGG - Intergenic
1043343770 8:79274343-79274365 ATGTGCTCCAAGACTACCTAGGG - Intergenic
1044309560 8:90678110-90678132 ATCTCCTCCATGAAAAACAAAGG + Intronic
1048755042 8:137728932-137728954 CTCTCCTCCATGAATGGCTGTGG - Intergenic
1059947886 9:119430663-119430685 AACTCCTCCAAGAATAGAGAAGG + Intergenic
1061762468 9:132860028-132860050 ATCCCCTCCAGGAAAAGCTGTGG + Intronic
1192054455 X:67758975-67758997 CCTTCCTCCAAGAATAGCTAGGG - Intergenic
1193659712 X:84242488-84242510 ATCTCCTACAAGAAATGCTAAGG + Intergenic
1194818124 X:98470438-98470460 ATATTCTCCAATAATACCTAGGG - Intergenic
1198041621 X:132858798-132858820 ATCCCCTCCTGGGATAGCTAGGG + Intronic
1201569422 Y:15398336-15398358 ATATCCTCCATGAATGGCTTGGG + Intergenic
1201713125 Y:17013858-17013880 ATATCCTCCAAGAAGAGAGAAGG + Intergenic