ID: 1155003286

View in Genome Browser
Species Human (GRCh38)
Location 18:21706549-21706571
Sequence TCCCGCTGGCCCGTGATCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 58}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155003286_1155003299 24 Left 1155003286 18:21706549-21706571 CCCGCGATCACGGGCCAGCGGGA 0: 1
1: 0
2: 0
3: 8
4: 58
Right 1155003299 18:21706596-21706618 GGGCCCTGCACTCTGAGCGCCGG 0: 1
1: 1
2: 2
3: 29
4: 201
1155003286_1155003293 -6 Left 1155003286 18:21706549-21706571 CCCGCGATCACGGGCCAGCGGGA 0: 1
1: 0
2: 0
3: 8
4: 58
Right 1155003293 18:21706566-21706588 GCGGGAGTTCCGGGTGGGTGTGG 0: 2
1: 59
2: 722
3: 740
4: 696
1155003286_1155003297 3 Left 1155003286 18:21706549-21706571 CCCGCGATCACGGGCCAGCGGGA 0: 1
1: 0
2: 0
3: 8
4: 58
Right 1155003297 18:21706575-21706597 CCGGGTGGGTGTGGGCTCGGCGG 0: 14
1: 162
2: 666
3: 602
4: 611
1155003286_1155003294 -5 Left 1155003286 18:21706549-21706571 CCCGCGATCACGGGCCAGCGGGA 0: 1
1: 0
2: 0
3: 8
4: 58
Right 1155003294 18:21706567-21706589 CGGGAGTTCCGGGTGGGTGTGGG 0: 2
1: 52
2: 684
3: 691
4: 595
1155003286_1155003295 0 Left 1155003286 18:21706549-21706571 CCCGCGATCACGGGCCAGCGGGA 0: 1
1: 0
2: 0
3: 8
4: 58
Right 1155003295 18:21706572-21706594 GTTCCGGGTGGGTGTGGGCTCGG 0: 63
1: 709
2: 625
3: 344
4: 428
1155003286_1155003298 4 Left 1155003286 18:21706549-21706571 CCCGCGATCACGGGCCAGCGGGA 0: 1
1: 0
2: 0
3: 8
4: 58
Right 1155003298 18:21706576-21706598 CGGGTGGGTGTGGGCTCGGCGGG 0: 14
1: 112
2: 578
3: 634
4: 695
1155003286_1155003302 28 Left 1155003286 18:21706549-21706571 CCCGCGATCACGGGCCAGCGGGA 0: 1
1: 0
2: 0
3: 8
4: 58
Right 1155003302 18:21706600-21706622 CCTGCACTCTGAGCGCCGGCTGG 0: 1
1: 0
2: 1
3: 18
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155003286 Original CRISPR TCCCGCTGGCCCGTGATCGC GGG (reversed) Intronic
907012748 1:50978262-50978284 GCCCGCTGGCCCTTGCTCCCTGG - Intergenic
908745942 1:67376541-67376563 TCCCTCTGGGCTGTGATCTCTGG - Intronic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
1069714793 10:70513870-70513892 ACCTGCAGGCCCGTGATGGCTGG + Intronic
1074203453 10:111259908-111259930 TCCAGCTGACCCCTGATGGCAGG - Intergenic
1074891174 10:117737709-117737731 TGCTGCTTGCCCATGATCGCGGG + Intergenic
1076617537 10:131765912-131765934 TCCTGCTGGCCACTGATCGGAGG - Intergenic
1077297167 11:1831707-1831729 AACTGCTGGCCCGTGATAGCTGG - Intronic
1079035030 11:17013878-17013900 TCCCGCCGGCCCGGGCTCGTTGG - Intronic
1081528664 11:43943451-43943473 TCGCCCTGGCCCGGGAGCGCCGG + Intronic
1081858873 11:46320669-46320691 TCCTGCTGGACAGTCATCGCTGG + Intronic
1083886600 11:65576240-65576262 TCCCGCTGGCCCGCCACCGCTGG - Exonic
1096639678 12:52984150-52984172 TCCATCAGGCCCGTGATCTCAGG - Intergenic
1097281233 12:57846443-57846465 TCCCGCGGGCCCGGGCTGGCTGG + Exonic
1097981767 12:65742601-65742623 TCCCGCCGGCGCGTGCTCGCTGG - Intergenic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1102409471 12:112704671-112704693 TCCTGTTGGCCCAGGATCGCAGG - Intronic
1104931344 12:132340995-132341017 TCACCCTGGCCCCTGATCCCTGG + Intergenic
1106594945 13:31127828-31127850 TCCCCCTGGCCCATGAAAGCAGG - Intergenic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1116653745 14:47626588-47626610 TCGCGCTGGCCCGCAAGCGCCGG - Intronic
1117175753 14:53145015-53145037 TGGCGCTGGCCTGTGATCCCAGG + Intronic
1117522681 14:56566407-56566429 TCCCGCTGGTCTGTGAGCTCTGG + Intronic
1128547581 15:68578673-68578695 TCCCGCTGGCCCGGGGACGCTGG - Intergenic
1131912560 15:97224278-97224300 TCGCGCTGGCCCGCCAGCGCCGG - Intergenic
1135616495 16:23915115-23915137 TCCCGTTAGCCCCTGATCTCTGG + Intronic
1137274101 16:46922285-46922307 ACCAGCTGGCCCTTGATCTCAGG - Exonic
1147839503 17:43361301-43361323 TGTTGCTGGCCCTTGATCGCTGG - Intergenic
1153226889 18:2906639-2906661 TCCCGCTGGCCTGACGTCGCAGG + Intronic
1155003286 18:21706549-21706571 TCCCGCTGGCCCGTGATCGCGGG - Intronic
1165902531 19:39175416-39175438 TCCTGCTGACCCATGATGGCAGG + Exonic
1166375467 19:42324768-42324790 TCCCGCTGTTCCGTGACCTCCGG + Exonic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
929074296 2:38065604-38065626 TCCCTCTGGCCAGTGCTCACGGG + Intronic
938385747 2:130865796-130865818 TCCAGCTGGCTCTTGATCTCAGG + Intronic
939538117 2:143458525-143458547 TTCCTCTGGCCCATGATCACCGG - Intronic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1168906483 20:1408098-1408120 TCCCCATGGCCCTTGATCACAGG + Intergenic
1179888534 21:44324774-44324796 TCCTGCTGGCCCCGGATCGCCGG + Intronic
1180219214 21:46347332-46347354 TCCTGCTAGCCCGTGAATGCTGG + Intronic
949292724 3:2484941-2484963 TCGCGCTGGCCGGTGAGCGCAGG - Intronic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
950118707 3:10467888-10467910 TCCCGCTCTCCCCTGATCCCAGG + Intronic
952956903 3:38563227-38563249 CACCGCTGGCCTGTGATCACAGG + Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
954383618 3:50232913-50232935 TCCCACTGGCCCCTGTTCCCAGG - Intronic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
962677982 3:137770404-137770426 TCCCGCAGAGCCGTCATCGCAGG + Intergenic
963718520 3:148832849-148832871 TCCCGCTGGCACATAATTGCTGG - Intronic
968092271 3:195906833-195906855 TCCCTCTGGCCCCTGAGCCCGGG - Intronic
970692026 4:18630900-18630922 TCACGCTGGCCTGCGAGCGCAGG + Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
983425673 4:167581591-167581613 TCGCCCTGGCCCGTGAGTGCAGG - Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
996482259 5:123988536-123988558 TCCCTGTGGCCAGTGATAGCAGG - Intergenic
996575919 5:124976426-124976448 TCATGCTGGCCTGTGAGCGCCGG + Intergenic
1006392364 6:33765997-33766019 ACCCGATGGCCCGTGATAGCCGG - Intergenic
1012237619 6:96837220-96837242 TCCCGCGGGCCGGGGATCGCGGG + Intronic
1018551359 6:165001912-165001934 TCGTGCTGGCCCGCGAGCGCTGG + Intergenic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1043847261 8:85177436-85177458 GCCTGCTGGCCCGAGCTCGCGGG - Exonic
1044242445 8:89902692-89902714 GCCCGCTGGCTCGGGGTCGCGGG - Exonic
1062656496 9:137606510-137606532 TGCCGCTGGACCTTGACCGCTGG + Intronic
1188881779 X:35499307-35499329 TCCCGCTGGCTCGCAAGCGCCGG - Intergenic
1200224443 X:154409385-154409407 TCCCGCTGGCCCGGGAAGGCGGG - Intronic