ID: 1155007500

View in Genome Browser
Species Human (GRCh38)
Location 18:21741513-21741535
Sequence TGCCGCCGGGGGGCCCGTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 61}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155007500_1155007509 -10 Left 1155007500 18:21741513-21741535 CCCTCACGGGCCCCCCGGCGGCA 0: 1
1: 0
2: 0
3: 9
4: 61
Right 1155007509 18:21741526-21741548 CCCGGCGGCAGCGGCGGCGGCGG 0: 3
1: 46
2: 345
3: 2022
4: 3429
1155007500_1155007514 5 Left 1155007500 18:21741513-21741535 CCCTCACGGGCCCCCCGGCGGCA 0: 1
1: 0
2: 0
3: 9
4: 61
Right 1155007514 18:21741541-21741563 GGCGGCGGCGGCGGCAGCGGCGG 0: 53
1: 1174
2: 1692
3: 2810
4: 5585
1155007500_1155007513 2 Left 1155007500 18:21741513-21741535 CCCTCACGGGCCCCCCGGCGGCA 0: 1
1: 0
2: 0
3: 9
4: 61
Right 1155007513 18:21741538-21741560 GGCGGCGGCGGCGGCGGCAGCGG 0: 104
1: 1218
2: 1745
3: 2910
4: 5735
1155007500_1155007511 -7 Left 1155007500 18:21741513-21741535 CCCTCACGGGCCCCCCGGCGGCA 0: 1
1: 0
2: 0
3: 9
4: 61
Right 1155007511 18:21741529-21741551 GGCGGCAGCGGCGGCGGCGGCGG 0: 34
1: 1171
2: 1665
3: 2918
4: 5848
1155007500_1155007512 -4 Left 1155007500 18:21741513-21741535 CCCTCACGGGCCCCCCGGCGGCA 0: 1
1: 0
2: 0
3: 9
4: 61
Right 1155007512 18:21741532-21741554 GGCAGCGGCGGCGGCGGCGGCGG 0: 63
1: 1208
2: 1776
3: 3026
4: 6001
1155007500_1155007515 19 Left 1155007500 18:21741513-21741535 CCCTCACGGGCCCCCCGGCGGCA 0: 1
1: 0
2: 0
3: 9
4: 61
Right 1155007515 18:21741555-21741577 CAGCGGCGGAGCCCACCGCCCGG 0: 1
1: 0
2: 1
3: 12
4: 169
1155007500_1155007516 20 Left 1155007500 18:21741513-21741535 CCCTCACGGGCCCCCCGGCGGCA 0: 1
1: 0
2: 0
3: 9
4: 61
Right 1155007516 18:21741556-21741578 AGCGGCGGAGCCCACCGCCCGGG 0: 1
1: 0
2: 0
3: 10
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155007500 Original CRISPR TGCCGCCGGGGGGCCCGTGA GGG (reversed) Exonic
903950545 1:26993811-26993833 TGCGGCCCGGGGGCCCAGGAGGG + Exonic
922241084 1:223755859-223755881 TGGCTGTGGGGGGCCCGTGAAGG - Intronic
1065367870 10:24952707-24952729 TCCCGCCGGCGGGCCCGGGGCGG - Intergenic
1075163109 10:120041903-120041925 TGCCGGCCGGGGCCCAGTGAGGG - Intergenic
1077222852 11:1425084-1425106 TGCTGCCCCGAGGCCCGTGATGG + Intronic
1083401538 11:62426579-62426601 TGCCTCCGGTGGGGCCTTGATGG + Intergenic
1112505216 13:99971043-99971065 GGCCGCCGCGGGGGCCGTGGCGG + Exonic
1113695422 13:112342638-112342660 TCCCTCCGGGGGGCCAGGGAGGG - Intergenic
1117424516 14:55580520-55580542 TGCCGCCGCGGGGCTCTTGTTGG + Intronic
1122370255 14:101225583-101225605 GGCCCCCGGGGGGCCCTTGTGGG - Intergenic
1122819499 14:104334321-104334343 AGCCGCCGGCTGGCCCGAGAGGG - Intergenic
1145263765 17:21369647-21369669 TGGCGCCGGGGGCCCAGTGTGGG - Intergenic
1147747272 17:42702509-42702531 TGCTGCCGTGGGGCCTGGGAGGG + Exonic
1151529748 17:74696645-74696667 TGCCCCCCGGGGGCCCGGGAGGG - Intronic
1152877928 17:82798610-82798632 TGCTGCCAGGGGTCTCGTGAGGG + Intronic
1155007500 18:21741513-21741535 TGCCGCCGGGGGGCCCGTGAGGG - Exonic
1159402011 18:67950849-67950871 TGCAGCCAGGGAGCACGTGATGG + Intergenic
1160864318 19:1250329-1250351 CGCCGCCGGGGGCCCCGCGCCGG - Exonic
1160880095 19:1315802-1315824 AGCCGCGGGGGGGCCAGAGAGGG - Intergenic
1162402155 19:10453030-10453052 TGCCGCGGGGGGGCCCGTTGGGG + Intronic
1166882873 19:45939947-45939969 GGCCGCGGGGCTGCCCGTGATGG + Exonic
1168277080 19:55284333-55284355 GGCAGCCGGGGGGGCCGGGACGG + Exonic
930762315 2:55050063-55050085 TGCCGCCGGCGCGCCCCTGATGG - Exonic
932374867 2:71226818-71226840 TGCCGCCGTCGGGGCTGTGAAGG - Intronic
932567813 2:72920543-72920565 CGGCGCCGGAGGGCCCGAGACGG - Intronic
934713357 2:96529530-96529552 TGCCTCAGGTGGGCCCTTGAAGG + Intergenic
936547737 2:113407049-113407071 TGCCGCTGGGGATGCCGTGAAGG - Intergenic
941448909 2:165635183-165635205 GGCCCCTGGGGTGCCCGTGAGGG + Intronic
942241103 2:173964670-173964692 CGCCGCCGGGGGGCGGGTGGGGG - Intronic
944273161 2:197805183-197805205 TGCCGCCGGGGACTGCGTGACGG + Exonic
945045284 2:205776328-205776350 GGCCGCCGGGGGCGCCGTGCTGG + Intronic
1172271860 20:33659537-33659559 TCCAGCCGGGGGGCCTGTGAGGG + Exonic
1173790331 20:45824057-45824079 GGCCTCCGGGGAGCACGTGACGG - Exonic
1175847021 20:62064838-62064860 GGCCGCCGGGGGCCCCGCGGGGG - Exonic
1176194329 20:63830617-63830639 TGCCGGCGGGGGGCGCGGGCGGG + Intronic
1176236777 20:64057084-64057106 TGCGGCCGCTGGGTCCGTGAAGG + Intronic
1176308189 21:5135342-5135364 TGCGGCAGGTGGGCCCGTGCTGG + Intronic
1177792517 21:25735649-25735671 GGCCGCGGGGGGGCCCTTGTGGG - Intronic
1179829711 21:43988983-43989005 TGTGGCCAGGGGGCCTGTGAGGG + Intergenic
1179848871 21:44126690-44126712 TGCGGCAGGTGGGCCCGTGCTGG - Intronic
1181000650 22:19986515-19986537 TGCCTCCGAGGCGCACGTGATGG - Intronic
1183182394 22:36268846-36268868 TGCGGCCTGGGGTCCTGTGAAGG + Intergenic
1183231472 22:36584829-36584851 TGCCGCAGGGGAGGCTGTGAGGG - Intronic
1184641944 22:45877551-45877573 TGCAGCCGGGGTGCTCGTGAGGG - Intergenic
954333400 3:49902669-49902691 AGGCGCCGGGGGGCCCCAGAAGG - Exonic
1003045359 6:2728643-2728665 TGCAGCTGGGAGGCCCGTGGAGG + Intronic
1010032811 6:71288565-71288587 GGCCGCCGGGGGCCGCGTGAAGG + Intergenic
1013008980 6:106103121-106103143 TGCTGACGGGGGGGCCGTGATGG - Intronic
1013316880 6:108951705-108951727 CGACGCCAGGGGCCCCGTGAGGG - Intronic
1019272776 7:159829-159851 AGCCCCGCGGGGGCCCGTGAGGG - Intergenic
1019340793 7:507880-507902 TACCGCCGGGGGGTCAGGGAAGG - Intronic
1019557185 7:1638440-1638462 TACCGCCGGGGAGCCCGTGCTGG + Intergenic
1020204523 7:6104858-6104880 GGCCGCCGGGGGGCGCGCCAGGG - Intergenic
1028160161 7:87475875-87475897 TGCCGCCGGGGCGCCCGGCTGGG + Intronic
1029640330 7:101816179-101816201 AGCCGCCGGGGGGCCCGCGGCGG + Intronic
1029640421 7:101816439-101816461 TGCCGCCGCGGGACCGGGGAGGG + Intronic
1036133745 8:6140124-6140146 TGCCGCTAGGGGGCCCAGGAGGG - Intergenic
1059268842 9:113060244-113060266 TGCCGCCGGCGGGCCCCGGGAGG + Intergenic
1059269978 9:113065693-113065715 TGCCGCCGGCGGGCCCCGGGAGG + Intergenic
1059271112 9:113071141-113071163 TGCCGCCGGCGGGCCCCGGGAGG + Intergenic
1059272245 9:113076587-113076609 TGCCGCCGGCGGGCCCCGGGAGG + Intergenic
1059273380 9:113082029-113082051 TGCCGCCGGCGGGCCCCGGGAGG + Intergenic
1059274516 9:113087475-113087497 TGCCGCCGGCGGGCCCCGGGAGG + Intergenic
1059769638 9:117414088-117414110 TGACGGCGGGTGGCCAGTGACGG + Intronic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1061754839 9:132804997-132805019 TGCCGTTGGGGGGTCTGTGAGGG + Intronic
1062324186 9:136004539-136004561 TCCCACCAGGCGGCCCGTGAGGG - Intergenic
1062536580 9:137023716-137023738 GGCCGGCAGGGGGCCCGGGAGGG + Intronic
1187915493 X:24149625-24149647 TGCTGACGGCGGGCCCGTGCCGG + Intronic
1194787747 X:98107034-98107056 TGCTGCCAGGGGGCCCAGGAGGG + Intergenic
1200418209 Y:2935277-2935299 TGCTGACGGCGGGCCCGTGCCGG + Intronic