ID: 1155009472

View in Genome Browser
Species Human (GRCh38)
Location 18:21761581-21761603
Sequence AGGGAAGCAGCCTCTTTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 193}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155009472_1155009476 -6 Left 1155009472 18:21761581-21761603 CCACCTAAAGAGGCTGCTTCCCT 0: 1
1: 0
2: 0
3: 18
4: 193
Right 1155009476 18:21761598-21761620 TTCCCTCCCTCAGTGGACCTGGG 0: 1
1: 0
2: 2
3: 19
4: 245
1155009472_1155009479 -3 Left 1155009472 18:21761581-21761603 CCACCTAAAGAGGCTGCTTCCCT 0: 1
1: 0
2: 0
3: 18
4: 193
Right 1155009479 18:21761601-21761623 CCTCCCTCAGTGGACCTGGGTGG 0: 1
1: 0
2: 1
3: 16
4: 236
1155009472_1155009475 -7 Left 1155009472 18:21761581-21761603 CCACCTAAAGAGGCTGCTTCCCT 0: 1
1: 0
2: 0
3: 18
4: 193
Right 1155009475 18:21761597-21761619 CTTCCCTCCCTCAGTGGACCTGG 0: 1
1: 0
2: 2
3: 33
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155009472 Original CRISPR AGGGAAGCAGCCTCTTTAGG TGG (reversed) Intronic
902676845 1:18014653-18014675 AGGGAAGGAGCCTCTTTTCTAGG - Intergenic
903280894 1:22249243-22249265 AGGGACGCAGGCTCTGTGGGAGG + Intergenic
904657472 1:32060081-32060103 AGGGAAGCATCCTGGTCAGGTGG + Intronic
905142702 1:35860931-35860953 AAGGAGGCAGACTCATTAGGAGG + Intergenic
907047359 1:51307409-51307431 AGGGAAGCAGCCACATTAAATGG + Intronic
908769093 1:67580307-67580329 AAGGATGCAGCCTCTCTTGGTGG + Intergenic
909404211 1:75268303-75268325 AGGGAAGCACTCTCATGAGGAGG - Intronic
909597437 1:77422264-77422286 AGGGAAGGAGACTGGTTAGGAGG - Intronic
910789628 1:91037830-91037852 AGGAACACAGCGTCTTTAGGAGG - Intergenic
912420389 1:109538745-109538767 AGGGAAGCAGGCTCTGGAGTAGG + Intergenic
919851895 1:201678665-201678687 TGGAAAGCAGCCTCTTTTGTTGG - Intronic
921285845 1:213608374-213608396 TGCGAAGCTGCCTCTTTAGGGGG - Intergenic
922341096 1:224655727-224655749 AGGGAAGAAGCCTTTTTATTAGG + Intronic
922788144 1:228293776-228293798 GAGGAAGCAGCCTCTCTAGCGGG + Intronic
923859136 1:237875520-237875542 AGGACAGCAGCATTTTTAGGAGG + Intergenic
924081726 1:240405962-240405984 AGGGAAGCAGCCTCAGGAGTGGG + Intronic
924081734 1:240405993-240406015 AGGGAAGCAGCCTCAGGAGTGGG + Intronic
924081786 1:240406179-240406201 AGGGAAGCAGCCTCGGGAGTCGG + Intronic
924081796 1:240406210-240406232 AGGGAAGCAGCCTCGGGAGTGGG + Intronic
924081804 1:240406241-240406263 AGGGAAGCAGCCTCGGGAGTCGG + Intronic
924081814 1:240406272-240406294 AGGGAAGCAGCCTCGGGAGTGGG + Intronic
924081824 1:240406303-240406325 AGGGAAGCAGCCTCGGGAGTGGG + Intronic
924081834 1:240406334-240406356 AGGGAAGCAGCCTCGGGAGTGGG + Intronic
924081844 1:240406365-240406387 AGGGAAGCAGCCTCGGGAGTGGG + Intronic
924339497 1:243015131-243015153 AGGGAGGCAACCTCTGAAGGTGG + Intergenic
1063765740 10:9138085-9138107 AGGGATTCAGCCTCTTTCAGTGG + Intergenic
1063923305 10:10952400-10952422 AGGGCTGGAGCCTCTTGAGGTGG + Intergenic
1070496778 10:77031675-77031697 AGAGATGCAGCCTCTGTTGGAGG + Intronic
1070711216 10:78684542-78684564 AGTGCAGCAACCCCTTTAGGGGG + Intergenic
1075300274 10:121316184-121316206 ATGGAAGCACCCTCATGAGGGGG + Intergenic
1075343535 10:121665722-121665744 ACTGAAGCAGGCTCTTGAGGAGG - Intergenic
1076686475 10:132200511-132200533 AGGTAAGCAGCCTCTCCAGGTGG + Exonic
1081002297 11:37690245-37690267 AGGTTAGCAGCCTCAATAGGTGG - Intergenic
1081504976 11:43706604-43706626 AGGGAAGCTGCCTTTTTGGTTGG + Intronic
1081752182 11:45519001-45519023 AGGGAAGAAACCTCATTATGTGG - Intergenic
1082694956 11:56351462-56351484 TGGGAAGCAGCAACTTTGGGTGG + Intergenic
1084596134 11:70118103-70118125 ATGGAAGAAGCATTTTTAGGGGG - Intronic
1084629513 11:70338063-70338085 AGAGAAGCAGACTCTTTTAGAGG - Intronic
1086314304 11:85574351-85574373 AGGAAAGCAGCATATTTGGGGGG - Intronic
1089276205 11:117337685-117337707 TGGGCAGCAGCCTCCTCAGGTGG + Intronic
1089646850 11:119886235-119886257 AGGGATGCAGCCTGCTTATGAGG - Intergenic
1091970791 12:4785253-4785275 AGGCAGGCAGCCTCTATAGGCGG - Intronic
1096003033 12:48145153-48145175 GGGGAACCAGCCTCTATAGAGGG - Intronic
1096081133 12:48833261-48833283 AGGGAAGCAGCCTTACTTGGCGG + Exonic
1100355260 12:93822559-93822581 AGAGAAGCAGACTGTTTGGGAGG + Intronic
1101045941 12:100806036-100806058 AGGGATGAAGGCTCCTTAGGTGG + Intronic
1101594700 12:106153866-106153888 GGGGAAACAGCCTTTTTAGTGGG + Intergenic
1101655819 12:106719288-106719310 AGGCAAGCAGCCTCTCTGTGTGG - Intronic
1101819933 12:108175773-108175795 AGGGAAGCAGCCAGCATAGGAGG + Intronic
1102228567 12:111246867-111246889 AGGGAAGCAGCGCTTTGAGGAGG - Intronic
1102532596 12:113557768-113557790 TGGCAAGCAGCCTCATAAGGTGG - Intergenic
1106351846 13:28937992-28938014 AGGGAAGCATCCTCATTCCGAGG - Intronic
1108542587 13:51457307-51457329 AGGGCAGCAGCCACTTCAGACGG + Intergenic
1108546449 13:51500149-51500171 ACTGAAGCAACCTCTTAAGGTGG + Intergenic
1109619332 13:64880466-64880488 AGGGAAGCACCCTGTAGAGGAGG - Intergenic
1111445079 13:88336593-88336615 GGGGAAATTGCCTCTTTAGGGGG + Intergenic
1111803309 13:93006175-93006197 GGGGAAGCAGTCTCCTAAGGTGG + Intergenic
1112023873 13:95394880-95394902 AGGGAAGCAGCCTGGTGTGGTGG + Intergenic
1113502431 13:110787093-110787115 AGGGAAGCAGGCTCATTACCTGG - Intergenic
1113503321 13:110795032-110795054 GGGGGAGCAGCCTCTGCAGGAGG - Intergenic
1114720896 14:24880812-24880834 AGGGAAGCAGGGACTTTAGAGGG + Intronic
1115643936 14:35353900-35353922 AGGGAAGCAGCTTCTGTTGATGG + Intergenic
1121798340 14:96753946-96753968 AGGGAAGCATGCCCTTGAGGGGG + Intergenic
1123214264 14:106791887-106791909 AGGGGAGCAGCCACTTTATATGG - Intergenic
1123980039 15:25593457-25593479 AGGGCATCAAACTCTTTAGGAGG + Intergenic
1124101115 15:26694138-26694160 AGGGAAGAAGACTCTATGGGTGG - Intronic
1129377994 15:75146009-75146031 ATGGCAGCAGCCACTTTAGACGG + Intergenic
1129743536 15:78002119-78002141 ATGGAAACAGCCTCTGTAGGTGG - Intronic
1129850213 15:78789507-78789529 AGGGAAGCAGCCTGGTTGTGGGG + Intronic
1130886458 15:88096536-88096558 AAGGATGCAGGCTCTTGAGGTGG - Intronic
1133551884 16:6864112-6864134 AGCGAAGGAGTCTCTTTAGCAGG + Intronic
1134142973 16:11737873-11737895 AAGGAAGCAACCTAATTAGGAGG + Intronic
1134314662 16:13107594-13107616 AGGGAAGAAGGCTCTTCAGGGGG + Intronic
1141687495 16:85578656-85578678 AGGGAAGCTGCCTGATTCGGGGG - Intergenic
1142527239 17:552206-552228 TGGGAAGCAGGTTCTTTGGGAGG - Intronic
1142893610 17:2960637-2960659 AGGCAAGCAGCCTCCTTCTGGGG + Intronic
1144058535 17:11561493-11561515 AGGGCAGAAGCCTGGTTAGGAGG - Exonic
1145212945 17:21028620-21028642 AGGAATGCAGCCTGTTGAGGTGG + Exonic
1146416246 17:32635779-32635801 AGGAAAGGAGCCTCTATAGAAGG + Intronic
1147056858 17:37841407-37841429 AGGCAAGCAGCTTATTTGGGAGG + Intergenic
1147872902 17:43600202-43600224 AGGGAAGAGGCCTCTTTACGGGG - Intergenic
1147919112 17:43905744-43905766 TGGGAAGAATCCTCTTTTGGGGG - Intronic
1149015571 17:51905000-51905022 AACGAAGCAGCCACCTTAGGAGG - Intronic
1149485158 17:57036837-57036859 AGGTAAGCAACCTCTTTCTGGGG + Intergenic
1149688242 17:58551358-58551380 ATGGGAGCAGCCACTTCAGGAGG + Intergenic
1150969401 17:70010550-70010572 TAGGGAGCAGCCTCTTAAGGTGG - Intergenic
1151199798 17:72459380-72459402 AGGGAAGCAGCATGTAGAGGGGG - Intergenic
1151227483 17:72657886-72657908 AGGGAAGCTGGCTCTCTAGAGGG - Intronic
1151496355 17:74460509-74460531 AGGAGAGCAGCTTCTTTAGGGGG + Intergenic
1151725457 17:75881284-75881306 AGGGACCCAGCCTCTTGGGGAGG + Intronic
1152239119 17:79152427-79152449 AAGGAAGCAACCTCCTTAGGGGG + Intronic
1155009472 18:21761581-21761603 AGGGAAGCAGCCTCTTTAGGTGG - Intronic
1156547480 18:37979243-37979265 AGGAACGTAGCCTCTTCAGGAGG - Intergenic
1158193694 18:54860359-54860381 ATGGAAGCAGAAGCTTTAGGGGG - Intronic
1166931034 19:46301352-46301374 AGGGAAGCAGAACCTCTAGGAGG - Intronic
1167588017 19:50385871-50385893 AGGGAAGGAACCTCTCTAGGGGG - Intronic
1168718607 19:58542733-58542755 AGGGAAGCAGCGTCTGTGTGGGG - Intergenic
927921542 2:26975874-26975896 CGGGAAGCAGCCACTTTGGAGGG - Intronic
930663332 2:54077659-54077681 AGGGAAGCAGCCCTTCAAGGAGG + Intronic
931616757 2:64167197-64167219 AGAGAAGCAGACTCATTAGGAGG - Intergenic
932873746 2:75429563-75429585 AAAGAAGCTGCATCTTTAGGAGG + Intergenic
934061514 2:88298507-88298529 AGGGAAGGAGCATATTTGGGGGG - Intergenic
934659910 2:96137897-96137919 AGGGAAGGAGCTCCCTTAGGGGG + Intronic
936366018 2:111856447-111856469 AGTGAAGCTTCCTATTTAGGTGG - Intronic
936516735 2:113185794-113185816 AGGGAGGGAGCCTCTGGAGGTGG + Intronic
936554403 2:113481394-113481416 AGGGAATGAGTCTCTTTGGGGGG - Intronic
937640176 2:124203264-124203286 AGGGAATCAGCCTCTTTCACTGG - Intronic
942447818 2:176089953-176089975 TGGGAATCAGTTTCTTTAGGTGG - Intergenic
945856169 2:215072426-215072448 AGGGAAGCAGAGTTTTTAGAAGG + Intronic
946332421 2:219017962-219017984 GGGGAAACTGGCTCTTTAGGGGG - Intronic
948110900 2:235455109-235455131 CTGAAAGCAGCATCTTTAGGTGG + Intergenic
949066162 2:241991535-241991557 AGGGAAGCAGGCTCTTCGGGAGG - Intergenic
1174033577 20:47651177-47651199 GGGGAAGCAGTCACATTAGGAGG - Exonic
1174268768 20:49351495-49351517 CGGGAAGCAGGCACTTAAGGAGG + Intergenic
1174830676 20:53809306-53809328 AAGGCAGCAGCCTCTGGAGGAGG - Intergenic
1175158157 20:56988244-56988266 AGGGAAGCAACGTCTTCACGGGG - Intergenic
1176124671 20:63470164-63470186 AGGGAGGCGGCCCCTTTGGGAGG - Intronic
1180750599 22:18121772-18121794 AAGGAAGCAGCGTCTCTAGCTGG + Intronic
1181876641 22:25945656-25945678 AAGGAGGCAGCCTCATGAGGAGG + Intronic
1184548853 22:45193035-45193057 ATGGAAGCAGCCTCTGGAGGGGG - Intronic
1184791223 22:46701318-46701340 GGGGCAGCAGCCTCTGGAGGAGG + Intronic
949403791 3:3693706-3693728 AGAGATGCAGGCTCTTGAGGTGG + Intergenic
950448343 3:13051285-13051307 AAGGAAGCAGCCTCCCCAGGAGG - Intronic
950709834 3:14806174-14806196 AGGGCAGCAGCCTGTGGAGGTGG - Intergenic
953411828 3:42694813-42694835 AGGGTAGAAGCTTCTTTAGTCGG - Intronic
959267345 3:104159086-104159108 AGAGAAGCAGATTCTTTAGATGG + Intergenic
962359312 3:134724078-134724100 AGGGAATCAGCCTCTGCTGGTGG - Intronic
962607204 3:137042505-137042527 CTGAAAGCAGCCTCCTTAGGAGG - Intergenic
966500643 3:180635100-180635122 GGGGAAGCAGCATCTTTACAAGG + Intronic
969547484 4:7841099-7841121 TGGGAAGCCGCCTCTATAGCAGG + Intronic
970726785 4:19055598-19055620 TGGGAAGCAGCTTCTTAAGGAGG + Intergenic
973198701 4:47475879-47475901 AGGGAGTCAGCCTCTTGTGGGGG + Intergenic
973570061 4:52229607-52229629 AGGTAAGTAACCTCTTTATGAGG - Intergenic
975445820 4:74463932-74463954 AGGGAAGCAGCTCTTTCAGGGGG + Intergenic
977447188 4:97145565-97145587 AGGGAAGGATCCACTTTTGGCGG - Intergenic
982615371 4:157634175-157634197 AGGGAAGCAAGCTCCGTAGGCGG - Intergenic
984745598 4:183212965-183212987 AGGGAAGCACCTTCTTGAAGAGG - Intronic
985483167 5:131098-131120 AAGGAAGCAGCTTCTTCAAGGGG - Intergenic
987373402 5:17213532-17213554 AGGGAAGCTGCCTCTTCCTGTGG - Intronic
991965008 5:72082039-72082061 GGGGATGCAGCCTCTGTAGAGGG - Intergenic
991975970 5:72183965-72183987 AGGGAACCAGCCACTTAATGGGG - Intronic
992130980 5:73692756-73692778 AGGGAAGCAGCTTCTTATTGAGG + Intronic
995245519 5:109931042-109931064 AGGGAAGCAGCATCATGTGGTGG - Intergenic
996474367 5:123899469-123899491 AAGGAAGAAGCCTCTTTATTTGG + Intergenic
997221797 5:132173830-132173852 AGGCAAGCAGCCACTAAAGGTGG + Intergenic
997226142 5:132210764-132210786 TGGGAAGGGGCCTTTTTAGGGGG + Intronic
999082362 5:148856466-148856488 AGCCAAGTAGCCTCTTGAGGTGG + Intergenic
999755898 5:154664061-154664083 AGGGGAGCAGCCTCTGGAGGTGG + Intergenic
1000962034 5:167611434-167611456 AGGGATGCAGCCTCCTTCTGTGG - Intronic
1003142727 6:3485197-3485219 GGGGTAGCATCCTCTTTGGGTGG - Intergenic
1003276548 6:4658825-4658847 GTGGAAGCAGACCCTTTAGGAGG + Intergenic
1004925437 6:20411495-20411517 CGGGAAGCAGCCACTGAAGGTGG - Intronic
1005189940 6:23209904-23209926 GAGGCAGAAGCCTCTTTAGGTGG - Intergenic
1006573570 6:35025896-35025918 AGGGAACCAGGCTGTTTAGTGGG - Intronic
1009404110 6:63291517-63291539 AGGGAAGGAGCATCTGAAGGTGG - Intronic
1009742100 6:67758800-67758822 TGGGAAGCAGCCTAGTTATGGGG - Intergenic
1010189110 6:73176348-73176370 AGGGAAGCAGGCTTCTTATGTGG - Intronic
1010521430 6:76842975-76842997 AGGGAAAAAGCCTCTTTTGTTGG + Intergenic
1014509861 6:122307808-122307830 TGGGAAGCAGCCCCCTGAGGTGG - Intergenic
1014843882 6:126252239-126252261 AGGCAAGCATCATCTTCAGGGGG - Intergenic
1015128586 6:129784158-129784180 AGGAAAACACCCTTTTTAGGTGG + Intergenic
1015498608 6:133907276-133907298 AGGGAAGCAAACTATTTAGAAGG - Intergenic
1017475363 6:154785853-154785875 AGAGAAATAGCCTTTTTAGGGGG - Intronic
1021087574 7:16440760-16440782 AGGGAAGCACCTTCTTTACATGG - Intergenic
1021403107 7:20232910-20232932 AGGTAAGCAGCCCACTTAGGTGG - Intergenic
1022735880 7:33075604-33075626 AAGGAAGAGGGCTCTTTAGGAGG + Intergenic
1022902523 7:34825043-34825065 AGGGAATCAGCCACCTCAGGAGG - Intronic
1024525822 7:50348479-50348501 AAGGAAGCAGCATCTTAAGGAGG - Intronic
1026232663 7:68498956-68498978 AGGGAAGAACCCTGTTTAGTTGG + Intergenic
1026915476 7:74117489-74117511 AGGGAAGCAGACCCTGTGGGAGG - Intronic
1027429082 7:78091245-78091267 AGGGAGGCAGAGTCTTTGGGAGG + Intronic
1029298024 7:99557190-99557212 TGGGAAGTGGCCTCTTTAAGTGG + Intronic
1032497249 7:132371614-132371636 AGGGAAGCAGCCACTTGGGAGGG + Intronic
1032525304 7:132575433-132575455 AGGGGAGCCTCCTCTTTTGGAGG + Intronic
1034894105 7:154864374-154864396 AGGGAAGCAGCCTCATGAGCAGG + Intronic
1038562207 8:28590230-28590252 AGGGAACCTCCCTCTTTTGGCGG - Intergenic
1040286062 8:46100986-46101008 ATGGAAGAAGCCTATTTGGGAGG + Intergenic
1040290276 8:46120629-46120651 ATGGAAGAGGCCTCTTTTGGAGG + Intergenic
1040299977 8:46182934-46182956 ATGAAAGAGGCCTCTTTAGGAGG + Intergenic
1040335779 8:46415265-46415287 AATGCAGCAGCCTCTTTAGCAGG + Intergenic
1042439012 8:68802732-68802754 AAGCAATCTGCCTCTTTAGGAGG + Intronic
1045632914 8:104147697-104147719 AGGGAAGCAGTCTGTTTTGCAGG - Intronic
1046646763 8:116793893-116793915 AGGGAAGGAGCCTAGCTAGGTGG + Intronic
1046809076 8:118513435-118513457 TGGGAAGCATCCTCTTTAACAGG - Intronic
1047681251 8:127256700-127256722 ATGGAAGCAGTATTTTTAGGAGG - Intergenic
1049425538 8:142536417-142536439 ACGGCAGCAGACTCTGTAGGAGG - Intronic
1049602930 8:143516301-143516323 AGGGAAGGAGCCCCTGTATGTGG + Intronic
1049898604 9:135790-135812 AGGGAATGAGTCTCTTTGGGGGG + Intronic
1050979219 9:11988096-11988118 TTGGAAGCAGACTCTTTAGGAGG + Intergenic
1052391302 9:27881591-27881613 AAGGAAGTAGCTTCTTTGGGAGG - Intergenic
1053564749 9:39237196-39237218 AGGGAAGCAGCCCTGTGAGGAGG - Intronic
1053741656 9:41146094-41146116 AGGGAATGAGTCTCTTTGGGGGG + Intronic
1053830528 9:42075097-42075119 AGGGAAGCAGCCCTGTGAGGAGG - Intronic
1054132402 9:61381838-61381860 AGGGAAGCAGCCCTGTGAGGAGG + Intergenic
1054346867 9:63975575-63975597 AGGGAATGAGTCTCTTTGGGGGG + Intergenic
1054444647 9:65302238-65302260 AGGGAATGAGTCTCTTTGGGGGG + Intergenic
1054485623 9:65719262-65719284 AGGGAATGAGTCTCTTTGGGGGG - Intronic
1054600032 9:67112358-67112380 AGGGAAGCAGCCCTGTGAGGAGG + Intergenic
1054686688 9:68285206-68285228 AGGGAATGAGTCTCTTTGGGGGG - Intronic
1055145288 9:72926522-72926544 AGGAAAGTAGCCTTTTTAAGAGG - Intronic
1058808722 9:108618276-108618298 ATGGAAGCAGTCTCTCTAGAGGG + Intergenic
1061513832 9:131077021-131077043 AGAGAAGCAGCCACTTTCCGAGG + Intronic
1062046929 9:134428630-134428652 AGAGCCGCAGCCTCTTTCGGGGG - Intronic
1185626508 X:1486585-1486607 AAGGAAACACCCCCTTTAGGGGG - Intronic
1186179508 X:6959325-6959347 TGGGAAGCAGACACTTCAGGTGG - Intergenic
1186701030 X:12090313-12090335 AGGGGAGCAGGCACTTTACGTGG - Intergenic
1193526641 X:82598546-82598568 ATGGCAGCAGCCGCTTAAGGGGG + Intergenic
1197610405 X:128632025-128632047 AGGGAAACAGGTTGTTTAGGAGG + Intergenic
1197838580 X:130721140-130721162 AGGGAAGCAGGCCCTGTCGGTGG - Intronic
1199235525 X:145488041-145488063 CAGGAAGCAGCATCTTCAGGTGG + Intergenic
1199504701 X:148548401-148548423 AGGGAAGCAGCTTCTTTATTTGG - Intronic
1199715926 X:150507413-150507435 AAGGAAGCAGCCTCCTCGGGAGG + Intronic