ID: 1155009961

View in Genome Browser
Species Human (GRCh38)
Location 18:21767439-21767461
Sequence TAATTCCCACACGTCGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7744
Summary {0: 1, 1: 12, 2: 227, 3: 2003, 4: 5501}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155009961_1155009965 6 Left 1155009961 18:21767439-21767461 CCTCCCTCGACGTGTGGGAATTA 0: 1
1: 12
2: 227
3: 2003
4: 5501
Right 1155009965 18:21767468-21767490 CTACAGTTCAAGATGAGATTTGG 0: 404
1: 4615
2: 7407
3: 9728
4: 10269
1155009961_1155009969 12 Left 1155009961 18:21767439-21767461 CCTCCCTCGACGTGTGGGAATTA 0: 1
1: 12
2: 227
3: 2003
4: 5501
Right 1155009969 18:21767474-21767496 TTCAAGATGAGATTTGGGCGGGG 0: 61
1: 7783
2: 11971
3: 10594
4: 7409
1155009961_1155009966 7 Left 1155009961 18:21767439-21767461 CCTCCCTCGACGTGTGGGAATTA 0: 1
1: 12
2: 227
3: 2003
4: 5501
Right 1155009966 18:21767469-21767491 TACAGTTCAAGATGAGATTTGGG 0: 512
1: 7568
2: 10888
3: 9439
4: 7502
1155009961_1155009967 10 Left 1155009961 18:21767439-21767461 CCTCCCTCGACGTGTGGGAATTA 0: 1
1: 12
2: 227
3: 2003
4: 5501
Right 1155009967 18:21767472-21767494 AGTTCAAGATGAGATTTGGGCGG 0: 463
1: 8259
2: 11742
3: 11333
4: 9185
1155009961_1155009968 11 Left 1155009961 18:21767439-21767461 CCTCCCTCGACGTGTGGGAATTA 0: 1
1: 12
2: 227
3: 2003
4: 5501
Right 1155009968 18:21767473-21767495 GTTCAAGATGAGATTTGGGCGGG 0: 9
1: 637
2: 9054
3: 13036
4: 12337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155009961 Original CRISPR TAATTCCCACACGTCGAGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr