ID: 1155011917

View in Genome Browser
Species Human (GRCh38)
Location 18:21787319-21787341
Sequence GTTCAGCAGCACTATACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 1, 2: 6, 3: 36, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155011917_1155011919 5 Left 1155011917 18:21787319-21787341 CCTGCAGTATAGTGCTGCTGAAC 0: 1
1: 1
2: 6
3: 36
4: 151
Right 1155011919 18:21787347-21787369 CTCTGATTTGATGTCTCTCTTGG 0: 1
1: 3
2: 1
3: 39
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155011917 Original CRISPR GTTCAGCAGCACTATACTGC AGG (reversed) Intronic
903059679 1:20661246-20661268 GTCCAGCAGCACTAAGGTGCGGG + Exonic
904426565 1:30427628-30427650 GTTCAGCAGCACCACATTGTAGG + Intergenic
911764104 1:101653712-101653734 GTTTAGCAGCATAATACTGTAGG - Intergenic
915880371 1:159664796-159664818 GTTCAGCAGCACCATGCAGTAGG - Intergenic
915966735 1:160315417-160315439 GCTCAGCAGCACTGCATTGCAGG + Intronic
916708088 1:167374203-167374225 CTCCAGCAGCACTGTGCTGCTGG - Exonic
918679160 1:187329702-187329724 GTTGAGCAGCATTATAGTGGTGG - Intergenic
918981362 1:191563979-191564001 GTGCAGCAGCACTAACTTGCAGG - Intergenic
921533205 1:216311095-216311117 GCTTAGCAGCACTATGATGCAGG - Intronic
921942195 1:220853730-220853752 GTTCAGCAGCACCATGCTGTAGG - Intergenic
922222038 1:223616045-223616067 GCCCAGCAGCACTGTACAGCAGG + Exonic
1065483180 10:26214551-26214573 GTTCTGCAACCCTAGACTGCTGG + Intergenic
1069126805 10:64645222-64645244 TTACTGCAGCACTATACTGTTGG + Intergenic
1069804693 10:71112980-71113002 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1070040357 10:72772204-72772226 GTTCAGCAGCACCATGCTGTAGG + Intronic
1070584859 10:77756487-77756509 GTTCAGTAGCACCACACTGTAGG + Intergenic
1072006380 10:91253661-91253683 GGTGAGCAGCACTAAACTGGGGG - Intronic
1072113419 10:92345562-92345584 TTTCAGCAGCAATGAACTGCAGG + Intronic
1072772096 10:98150713-98150735 GTTCAGCAGCACCACGCTGTAGG - Intronic
1073695429 10:105861101-105861123 GTTCAGCAGCACTTTTCCACAGG + Intergenic
1075206860 10:120456449-120456471 GTTCAGCAGCCCCAAGCTGCTGG + Intergenic
1076926329 10:133490001-133490023 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1077846135 11:6026915-6026937 TTTCTTCAGCACCATACTGCTGG - Exonic
1079147720 11:17868597-17868619 TTTCAGCAGCACCCTACTCCTGG + Intronic
1080192481 11:29568804-29568826 GTTCAGCAGCACTATGCTGTGGG + Intergenic
1080716995 11:34812505-34812527 GTTCAGCAGCACCATACTGTAGG + Intergenic
1080789369 11:35507992-35508014 ATTCAGTGGCACTATGCTGCAGG - Intronic
1084901679 11:72314668-72314690 GTTCAGGAGCAATTGACTGCAGG - Intronic
1086934343 11:92728460-92728482 CTTCAGCAGAACTGGACTGCTGG + Intronic
1087374828 11:97327198-97327220 GTTGAGCAGCAATAGCCTGCAGG - Intergenic
1087411278 11:97792851-97792873 GTCCAGCATCACTACACTGTAGG - Intergenic
1091165141 11:133468849-133468871 GTTCAGCAGCTCTGCCCTGCAGG + Intronic
1092941391 12:13410465-13410487 GTTTAGCAGCACCATGCTGTAGG + Intergenic
1093142663 12:15527549-15527571 GTTCAGCAGCACCATACTGTAGG + Intronic
1094096074 12:26706377-26706399 GATCAGCTGCACTACACTTCTGG + Intronic
1094322167 12:29196999-29197021 ATTAAGAAGCACTAGACTGCTGG - Intronic
1094471694 12:30807462-30807484 CTTCAGCAGCACCATGCTGTAGG + Intergenic
1095777632 12:46026740-46026762 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1099434551 12:82627897-82627919 GTTCAGCAGCACCGCACTGTAGG + Intergenic
1100804463 12:98266800-98266822 GTTCAGGAGCCCTATGCTGTAGG + Intergenic
1101364359 12:104058000-104058022 GTTCAGCAGCACCACACTGTAGG - Intronic
1106904881 13:34395402-34395424 GTTCAGCAGCACCACTCTACAGG + Intergenic
1106984644 13:35331427-35331449 GTTCAGCAGCATTATAATTTTGG - Intronic
1108769413 13:53680266-53680288 GTTCAGCAGTACCATGCTGTAGG - Intergenic
1109169370 13:59076569-59076591 TTTCAGCAGCACCCTACTCCTGG + Intergenic
1114362613 14:21991799-21991821 GTTCAGCAGCACTCGTTTGCGGG - Intergenic
1114920994 14:27328533-27328555 CTTTAGCAGAACTATAGTGCTGG + Intergenic
1115050433 14:29054427-29054449 TTACAGCAGCACTTTACTGAGGG + Intergenic
1115057465 14:29147514-29147536 GTTGAGAAGCACTATTCTGAAGG + Intergenic
1115279675 14:31647575-31647597 GTTCAGCAGCACCACATTGTAGG - Intronic
1116514007 14:45784434-45784456 GTTTAGCAGCCCTATGCTGTAGG - Intergenic
1116745597 14:48814591-48814613 GTTCAGCAGCACTATGCTGCAGG + Intergenic
1118857661 14:69636694-69636716 GTCCAGCAGCACTAGCCTCCAGG - Intronic
1124590668 15:31050412-31050434 GTTCAGCAGCTCTATCTTCCGGG + Exonic
1125365537 15:38911479-38911501 GTTCAGCAGCAGTATGGTGTAGG - Intergenic
1126269184 15:46792879-46792901 GTTCAGTAACACTATGCTGCAGG + Intergenic
1126815858 15:52452561-52452583 GTTCAGCAGTATCATACTGTAGG + Intronic
1127739844 15:61892261-61892283 GTTCAGCAGCACAACACTGTGGG + Intronic
1128584216 15:68833782-68833804 GTCCATCAGCACTGCACTGCAGG + Intronic
1134568358 16:15270387-15270409 GTTGAGAAGCACTAGGCTGCAGG + Intergenic
1134734072 16:16485973-16485995 GTTGAGAAGCACTAGGCTGCAGG - Intergenic
1134933427 16:18226308-18226330 GTTGAGAAGCACTAGGCTGCAGG + Intergenic
1139047175 16:63076056-63076078 GTTCAGCAGCACCACAGTGTAGG - Intergenic
1148403438 17:47388031-47388053 GTTCAGCAGTACCACACTGTAGG - Intronic
1149636273 17:58172488-58172510 GTCCAGCAGCACCATGCTGTAGG + Intergenic
1152811462 17:82384673-82384695 GTTCAGCAGCTCTAAATGGCAGG - Intergenic
1152992099 18:372884-372906 GTCCAGAAGCACTCTTCTGCTGG - Intronic
1154216802 18:12421305-12421327 GTGCAGCAGCACTATGCTCCCGG - Intronic
1155011917 18:21787319-21787341 GTTCAGCAGCACTATACTGCAGG - Intronic
1155113702 18:22742621-22742643 GTTCAGCAGCACCACACTGTAGG + Intergenic
1155978007 18:32152761-32152783 GTTCAGCAGCACCACACTGTAGG - Intronic
1159837209 18:73352708-73352730 GTTCAGCAGCAACACTCTGCAGG - Intergenic
1159906354 18:74096293-74096315 GTTCAGTAGCACCACACTACAGG + Intronic
1160429094 18:78799245-78799267 TTTCACCAGCACCACACTGCTGG + Intergenic
1162265753 19:9572560-9572582 GTTCAGGAGCACCATACTGTAGG + Intronic
1164796807 19:31040161-31040183 TTTCAGCAGCACTTACCTGCTGG + Intergenic
1165566185 19:36730293-36730315 GTTCAGCAGCAGCATGCTGTAGG + Intronic
1166623122 19:44322856-44322878 GTTCAGCATCACTATACTGTAGG - Intergenic
925739072 2:6989436-6989458 GTTCATAAGCACTATTCTCCAGG - Intronic
926610848 2:14945083-14945105 GTTCAGCAGCACCAAGCTGCCGG + Intergenic
926875397 2:17471139-17471161 GTTCAGCAGCACAATGCTGTAGG - Intergenic
928477194 2:31640689-31640711 GTTCAGTGGCACTATGCTGCAGG - Intergenic
930858753 2:56047228-56047250 GTTCAGCAGCACCTTGCTGGTGG + Intergenic
932609056 2:73185187-73185209 GTTCAGCAGCACCATCCTCTTGG - Intergenic
936022257 2:109003769-109003791 CTCCAGCAGCTCTATTCTGCAGG + Intergenic
936077562 2:109411432-109411454 GCTCAGCAGCACGCTACTGGGGG - Intronic
936753716 2:115678540-115678562 GTCCAGCAGAAGTCTACTGCAGG + Intronic
939847586 2:147267534-147267556 ATTCAGCAGCACCACACTGTAGG - Intergenic
943102479 2:183505172-183505194 GTTCAGCAGCATCATGCTGTTGG - Intergenic
943659505 2:190543260-190543282 GTTCATCAGCACTGTGCTGTCGG - Intergenic
948739962 2:240039849-240039871 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1169088405 20:2841133-2841155 CTTCAGCAGCACTTTCCGGCAGG - Intronic
1170863492 20:20130774-20130796 GTTCAGCAGCACCACACTGTAGG - Intronic
1171508347 20:25658171-25658193 GTTCACCAGCACCATGCTGTAGG - Intergenic
1173578826 20:44132070-44132092 GTTAACCAGCTCTGTACTGCTGG - Intronic
1176220251 20:63966194-63966216 GGTCAGCAGCACCATTTTGCAGG + Exonic
1177104841 21:16943030-16943052 GTTCAGCGGCACTATACTATAGG - Intergenic
1179364530 21:40744340-40744362 TTCCTGCAGCACTATAGTGCTGG - Intronic
1180109305 21:45640660-45640682 CTTCAGCAGGACTACACTCCAGG - Intergenic
1183205126 22:36413577-36413599 GTACAGCAGCCCTGTACTGCAGG - Intergenic
951847181 3:27097090-27097112 GTTGGCCAGCAATATACTGCTGG + Intergenic
951923306 3:27879284-27879306 GTTCTGAAGCACTACACTGGTGG + Intergenic
952972684 3:38662633-38662655 GTTCAGCAGCAACACACTGTAGG + Intergenic
954440460 3:50519010-50519032 GGACAGCAGCACTGAACTGCTGG - Intergenic
955395226 3:58552470-58552492 GTTCAGCAGCACCATGCTGTAGG - Intergenic
956066310 3:65400802-65400824 CTTTAGCAGCATTATGCTGCAGG - Intronic
958825627 3:99026825-99026847 GTTCAGCAGAACTGTCCTGTAGG + Intergenic
959679826 3:109082040-109082062 GTTCAGCAGCATCACACTGCAGG + Intronic
959771255 3:110100171-110100193 GTTCAGGAGGACTATTCTGGAGG + Intergenic
962763309 3:138538286-138538308 GTTCAGCAGCACCACACTGTAGG + Intronic
965017867 3:163182772-163182794 GTTCAGGTGCCCTATCCTGCGGG - Intergenic
965493411 3:169367673-169367695 CTTCAGCAGCACTCTACTGGTGG + Intronic
965719862 3:171649914-171649936 GCTCAGTAGCACAATACTTCTGG + Intronic
965867386 3:173221343-173221365 GTTCAGCAGCACCATATAGTAGG - Intergenic
969473823 4:7409399-7409421 GTTCAGCAGCACCATGCTGTTGG - Intronic
969543154 4:7806491-7806513 GCTCAGCAGCACTGCACTTCCGG + Intronic
971797346 4:31244696-31244718 ATTCAGCAGCACCACACTGTAGG + Intergenic
972375262 4:38463827-38463849 GTGCAGCATCACTTTTCTGCAGG + Intergenic
977586943 4:98784506-98784528 GCTAAGCAGCACTTTATTGCTGG - Intergenic
978888217 4:113791234-113791256 GTTCAGCAGCCCTATGCTGTAGG + Intergenic
980066209 4:128191628-128191650 GTTCAGCAGGACCACACTGTAGG - Intronic
980728088 4:136790576-136790598 GTTCAGCAGCACAATATTTCTGG + Intergenic
980868045 4:138576758-138576780 ATTCAGCAGCACCATGCTGTAGG + Intergenic
981159554 4:141481723-141481745 GTTCAGCAGCAGTATGCTGTAGG - Intergenic
981900692 4:149858378-149858400 ATTCAGCAGCACCATGCTGTAGG + Intergenic
983655622 4:170080587-170080609 GTTCAGCAGCACCACACTGCAGG + Intronic
983792771 4:171818859-171818881 GTTAATCAGCCCTACACTGCAGG + Intronic
987517839 5:18936937-18936959 GATCAGAAGAACTATACTGATGG - Intergenic
989673527 5:43947224-43947246 TTTCAGCAGCACTGCACTCCTGG + Intergenic
991011596 5:61888409-61888431 GTTCAGCAGCACCACACTTTAGG + Intergenic
991965412 5:72085890-72085912 GTTCAGAATCACAAAACTGCAGG + Intergenic
992654976 5:78900202-78900224 ATTCAGCAGCACCACACTGTAGG - Intronic
995278792 5:110308861-110308883 GTTTAGCAGCACCATACTGTAGG + Intronic
995333936 5:110977122-110977144 TTTCAGCAGCACTCCACTCCTGG + Intergenic
996113454 5:119592340-119592362 GTTCTGCAGCACCATGCTGTAGG + Intronic
997274734 5:132575073-132575095 TTTCAGCAGCACTCCACTCCTGG + Intronic
998061671 5:139123591-139123613 GGTCAGAAGCATTAGACTGCAGG + Intronic
999412402 5:151363277-151363299 GTTCAGCAGCACCACACTGTAGG - Intergenic
1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG + Intronic
1003095671 6:3141324-3141346 GTTAGGCAGGATTATACTGCGGG + Intronic
1005270019 6:24153620-24153642 GTGTAGCAGGACTATACTGGGGG + Intronic
1005407194 6:25502141-25502163 GTTTACCAGCACTTTACTGAGGG + Intronic
1006084342 6:31585857-31585879 GTTCTGCAGCTCTATGCAGCAGG - Intergenic
1012221575 6:96655858-96655880 GTTGTGCAGAACTATACTGAAGG + Intergenic
1013562939 6:111324677-111324699 ATTCAGCAGCACTAGAGTGAGGG + Intronic
1013687977 6:112608472-112608494 TTTCAGCAGCACTCCATTGCTGG - Intergenic
1016263771 6:142207445-142207467 GTTCAGCAGTACCATGCTGTAGG + Intronic
1016281874 6:142427599-142427621 TTTCAGCAGCACCATACTTCTGG + Intronic
1016615356 6:146041622-146041644 GTTCAGCAGCACCACATTGTAGG - Intronic
1016928041 6:149372927-149372949 GTTCTGAACCAGTATACTGCAGG - Intronic
1017186425 6:151605412-151605434 GTTCAGCAGGACCACACTGTAGG - Intronic
1017934132 6:158989534-158989556 GTTCAGCAGCACCACATTGTAGG - Intronic
1019697460 7:2453853-2453875 GTTATTCAGCATTATACTGCAGG - Intergenic
1019736208 7:2650965-2650987 TTTCAGCAGCTCTGTGCTGCGGG + Intronic
1021771830 7:24010811-24010833 GTTCAGCAGCACCACACTGTAGG - Intergenic
1023060327 7:36320543-36320565 TTTCAGCAGCACCCCACTGCTGG - Intergenic
1028082546 7:86596805-86596827 GTTCATCAGCAGTCTATTGCTGG + Intergenic
1028560362 7:92168460-92168482 ATTCAGCAGCACCATGCTGTAGG + Intronic
1033031697 7:137833187-137833209 TTTCAGCAGCACCCTACTCCTGG + Intronic
1035134002 7:156682486-156682508 ATTCACCAGTACTATACTGGTGG + Exonic
1038024503 8:23576674-23576696 GTTCATCAGCACACCACTGCTGG + Intergenic
1041478354 8:58290718-58290740 GTTCAATAGAACTATAATGCAGG + Intergenic
1042002341 8:64138699-64138721 ATTCAGCAGCACTGTACTGTAGG + Intergenic
1042574412 8:70202085-70202107 GTTCAACATCACTATTCAGCAGG + Intronic
1043033125 8:75164249-75164271 GTTCGGCAGCACCATGCTGAAGG - Intergenic
1044144609 8:88696299-88696321 GTTCGGCAACACTACACTGCAGG - Intergenic
1049953590 9:670597-670619 GTTCGGCAGCACTATGCTGTAGG - Intronic
1050841821 9:10158979-10159001 GTTCAGCAGCACCATGTTGTAGG + Intronic
1052689544 9:31800037-31800059 GTTCAGCAGCACCATGCTATAGG + Intergenic
1052734671 9:32328812-32328834 GTTCAGCAGCACCGTGCTGTAGG + Intergenic
1055211558 9:73801123-73801145 GTTCAGCATCACTAACCTCCAGG + Intergenic
1057296303 9:93845023-93845045 GTTCACCAGCACCATGCTGTAGG - Intergenic
1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG + Intergenic
1186994719 X:15107692-15107714 GGTCAGCAGCATCATACTGTAGG - Intergenic
1187243379 X:17532968-17532990 ATTCAGCATCTCTATACTACAGG - Intronic
1187714226 X:22086212-22086234 GTTCAGCAGCATTATGCTATAGG - Intronic
1187854719 X:23625799-23625821 ATTCTGCAGCACTATTCTGGTGG + Intergenic
1188382018 X:29506675-29506697 ATTCAGCAGTACTATACTGTAGG - Intronic
1188520904 X:31036606-31036628 GTTCAGCAGCCTTATACAGAAGG - Intergenic
1188599014 X:31938638-31938660 ATTCAGCAGTACTATACCTCAGG - Intronic
1188903135 X:35759739-35759761 GTTCAGTAGCACCACACTGTAGG - Intergenic
1192521931 X:71809823-71809845 GTTCAGCAGCGCCACACTGTAGG - Intergenic
1192760769 X:74094172-74094194 TTTCAGCAGCACCATGCTGGAGG + Intergenic
1194321020 X:92446719-92446741 TTTCAGCAGCACCCTACTCCTGG - Intronic
1194530037 X:95035917-95035939 GTTCATCAGCACCATGCTGTAGG - Intergenic
1195073568 X:101304636-101304658 GTTCAGCAGCATCATGCTGTAGG - Intergenic
1196882779 X:120213718-120213740 GTTTAGCAGCACCACACTGTAGG + Intergenic
1196980928 X:121212942-121212964 GGTCAGCAGCACCATGCTACAGG - Intergenic
1197146458 X:123177753-123177775 CTGTAGCAGCACTACACTGCTGG - Intergenic
1197260612 X:124313209-124313231 GTTCAGCAGCACCACACTGCAGG + Intronic
1197494851 X:127165736-127165758 ATTCAGCTGCACTGTACTGATGG - Intergenic
1199716801 X:150512489-150512511 GTTCAGCAGCACTCACCTTCTGG + Exonic
1200629138 Y:5559866-5559888 TTTCAGCAGCACCCTACTCCTGG - Intronic
1201414539 Y:13735083-13735105 CTTCAGCAGAACTAAACAGCTGG - Intergenic
1201726514 Y:17157878-17157900 GTTCAGAACCACTGTCCTGCAGG - Intergenic