ID: 1155017324

View in Genome Browser
Species Human (GRCh38)
Location 18:21857353-21857375
Sequence ACTTGGATCCACAGTGGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155017320_1155017324 0 Left 1155017320 18:21857330-21857352 CCTTATAAAACCTAAGATGTCTG 0: 1
1: 0
2: 0
3: 12
4: 162
Right 1155017324 18:21857353-21857375 ACTTGGATCCACAGTGGAACAGG 0: 1
1: 0
2: 0
3: 13
4: 85
1155017319_1155017324 27 Left 1155017319 18:21857303-21857325 CCTCTTCTCTTTCGTAATACACT 0: 1
1: 0
2: 0
3: 16
4: 258
Right 1155017324 18:21857353-21857375 ACTTGGATCCACAGTGGAACAGG 0: 1
1: 0
2: 0
3: 13
4: 85
1155017322_1155017324 -10 Left 1155017322 18:21857340-21857362 CCTAAGATGTCTGACTTGGATCC 0: 1
1: 0
2: 1
3: 7
4: 120
Right 1155017324 18:21857353-21857375 ACTTGGATCCACAGTGGAACAGG 0: 1
1: 0
2: 0
3: 13
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155017324 Original CRISPR ACTTGGATCCACAGTGGAAC AGG Intronic
907386269 1:54127573-54127595 TCTTGGAACCACTGTGGAAGCGG - Intergenic
911244558 1:95502429-95502451 GGTTTGATCCACAGAGGAACAGG - Intergenic
912572645 1:110635762-110635784 ACTTAGTTCCACAGTGGATGTGG + Intergenic
914981733 1:152420491-152420513 ACACGGCTCCACAGTGTAACTGG + Intergenic
915954785 1:160212747-160212769 ACTTGGATGGAAAGTGGAAAAGG + Intronic
923045253 1:230350835-230350857 ACTTGGACCCACAGTGAAAAGGG + Intronic
1063936778 10:11086539-11086561 ACATGGATTCACTGTGGAAGAGG - Intronic
1064669411 10:17695091-17695113 GCTTGGATACAAAGTGGAAAGGG - Exonic
1072454668 10:95565202-95565224 ACCTGGGTCCACAGGGAAACGGG + Intergenic
1076568699 10:131416927-131416949 ACTTGGAGCTACTGTGGAAAGGG - Intergenic
1083614136 11:64018175-64018197 ACTTGGATGCACGGAGGACCTGG + Intronic
1088822320 11:113467027-113467049 ACATGGATCCACCGTGGTGCGGG + Intronic
1091997384 12:5004386-5004408 ACTAGGGTCCACAGTGAAACTGG - Intergenic
1098965464 12:76783338-76783360 ACTTGCAATCACAGTGGAAGGGG + Intronic
1099646969 12:85369427-85369449 ACCTGGAGCCATAGTGGAGCTGG + Intergenic
1101457440 12:104850152-104850174 ACTTGGATCAACAGTAGACCTGG - Intronic
1101976655 12:109365507-109365529 ACTTGGAGCCTCAGTGGAGGTGG + Intronic
1107969451 13:45627294-45627316 ATTTGGCTCCACAGTGTAACAGG - Intergenic
1108933188 13:55857297-55857319 ACATGCATGCAGAGTGGAACTGG + Intergenic
1109381413 13:61566318-61566340 ACTTGGATCCTTTGTGAAACTGG + Intergenic
1110680318 13:78303075-78303097 ACTTGGATGCTAAGTGGAATCGG - Intergenic
1110730867 13:78877221-78877243 ACTTTGCTCCACACTGGAACAGG + Intergenic
1113236859 13:108286154-108286176 CTTTGGATCCAGAGTGAAACAGG + Intronic
1113345331 13:109472250-109472272 CCTTGGATCCACAGAGGGAAAGG - Intergenic
1114405217 14:22450119-22450141 ACTTGGTTCCACAGTCACACGGG - Intergenic
1125580995 15:40785669-40785691 ACCTGCATCCACTGTGGACCAGG - Intronic
1125691452 15:41599360-41599382 ACTCTGAACCCCAGTGGAACAGG - Intergenic
1126911129 15:53418190-53418212 GCTGGGATCCACAATTGAACAGG - Intergenic
1142851244 17:2705878-2705900 CCTTGGCTCCTCAGCGGAACAGG - Intronic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1144484460 17:15653223-15653245 GCTTCCATCCACAGTGGAAGGGG - Intronic
1155017324 18:21857353-21857375 ACTTGGATCCACAGTGGAACAGG + Intronic
1156645532 18:39157220-39157242 GGTTGGAGCCAAAGTGGAACTGG - Intergenic
1156650483 18:39220403-39220425 ACCTGGATCCACAGTTTAATGGG - Intergenic
1158749485 18:60242453-60242475 AGGTGGATCCACAGTGGAGCAGG + Intergenic
1161754939 19:6125793-6125815 ACCTGGATCCACAGTGACACAGG + Intronic
1162492679 19:11003179-11003201 ACTTGGATCCCCACTGCATCTGG - Intronic
926124338 2:10262727-10262749 CCTTGGACACACAGTGGGACTGG - Intergenic
927186066 2:20483525-20483547 AAGCTGATCCACAGTGGAACAGG + Intergenic
927481894 2:23460596-23460618 ACTTGGACACACAGTGGAGCTGG + Intronic
929266052 2:39920297-39920319 ACTTGCATGCACACTGGGACAGG - Intergenic
934325399 2:92009429-92009451 AGATGGAGACACAGTGGAACAGG + Intergenic
934732704 2:96669531-96669553 ACTGGGATCCACAGTAGATCCGG - Intergenic
934732859 2:96670298-96670320 ACTGGGATCCACAGTAGATCCGG - Intergenic
939801804 2:146720384-146720406 ACTTTGCTCCACACTGGAGCAGG - Intergenic
939902088 2:147862838-147862860 ACTTGGGTCAAAATTGGAACTGG + Intronic
940138014 2:150461125-150461147 ACTTGTAATCACAGTGGAAGGGG + Intergenic
1169143855 20:3240064-3240086 ACTGGGAGCCACCGTGGATCAGG - Intergenic
1177441809 21:21135763-21135785 ACTTGGAGTCCCAGTGGAAAAGG - Intronic
1179407290 21:41136511-41136533 ACTTTGCTCCTCACTGGAACAGG - Intergenic
951195956 3:19823500-19823522 GCTGGGATCCTCAGTGGCACAGG + Intergenic
951479021 3:23140025-23140047 ACTTGGTTCCACATTAGAATTGG - Intergenic
954036847 3:47855359-47855381 ACCTGGAACCACAAAGGAACTGG + Exonic
954233417 3:49236608-49236630 ACTGAGATCCAAAGAGGAACTGG - Exonic
955217431 3:56996183-56996205 CCTGGGTTCCACAGTGGAAATGG - Intronic
960891893 3:122457811-122457833 GCTAGGAACCAGAGTGGAACCGG - Intronic
964403905 3:156328845-156328867 ACTTGGCTCCACAGTCTACCTGG + Intronic
967114924 3:186328542-186328564 GCTTGAATTCACAGTGGAAAAGG + Intronic
976746513 4:88408510-88408532 TCTTGTATCCAAAGAGGAACTGG + Exonic
978883556 4:113739042-113739064 ACTTAGAACCACAGTGTAAATGG + Intronic
983690785 4:170465948-170465970 ACCTGCATGAACAGTGGAACTGG - Intergenic
988552606 5:32210265-32210287 TCTTGGAAGCACAGTGGACCTGG - Intergenic
990695488 5:58411932-58411954 TCTTGCAACCACAGTGCAACAGG - Intergenic
991501296 5:67279834-67279856 ACTTGGGGCCACAGTGCCACGGG - Intergenic
992465396 5:76999242-76999264 ACTTGGAAGCACAGCTGAACTGG + Intergenic
993952301 5:94191833-94191855 ACTTGGATCCCCAGTGGGGGTGG - Intronic
995576668 5:113543654-113543676 ATTTTTATCCACAGTGTAACTGG - Intronic
995934006 5:117486397-117486419 ACCTGAAGCCACAGTGGAAAGGG - Intergenic
996762263 5:126998410-126998432 GCTTGGATCAAGAGTGAAACTGG + Intronic
1008731227 6:54484993-54485015 ACTTTGCTCCAGAGTGGAAAAGG + Intergenic
1010791321 6:80068468-80068490 ACTTGGAGCCACAGTAAAATTGG + Intergenic
1011216925 6:85014951-85014973 CCTTGGAAGCACACTGGAACTGG + Intergenic
1011584319 6:88908557-88908579 CCTTAGGTCCACACTGGAACTGG - Intronic
1012163492 6:95918589-95918611 ACTTGGATCAACAGTCTAAACGG + Intergenic
1013060759 6:106631327-106631349 ACTTAGATTGACAGTGGAAAAGG - Intronic
1018150403 6:160931793-160931815 ACTTTGATCCTCGGTGGAAAGGG + Intergenic
1018984813 6:168628398-168628420 ACTTCGTTCCAAAATGGAACTGG + Intronic
1024559379 7:50630472-50630494 GCTTGGATCCACCGTGGATCTGG + Intronic
1028765692 7:94556525-94556547 AAATGGATCCACAGGGTAACTGG - Exonic
1030071191 7:105699079-105699101 GATTGTAGCCACAGTGGAACAGG + Intronic
1030556972 7:111038312-111038334 AATTGGAAGCACAGTGGAAAAGG + Intronic
1032464342 7:132134488-132134510 GCTTTGAGCCACAGTGGTACTGG + Intronic
1035474485 7:159132413-159132435 ACTGGGATCCAGAGTGAAACTGG + Intronic
1035478770 7:159164475-159164497 ACTGGGATCCAGAGTGAAACTGG - Intergenic
1040422179 8:47251181-47251203 ACTGGCAGCCACAGTGGCACTGG + Intergenic
1042263867 8:66888759-66888781 ATTTGGCTACACATTGGAACTGG - Intronic
1047077123 8:121416311-121416333 AGTAGGAGCCACAGTGGCACTGG + Intergenic
1048170940 8:132105601-132105623 ACTTTGATTCACTGTGGCACTGG + Intronic
1052204829 9:25827229-25827251 ACTTGAAGCCACAGTAGCACTGG + Intergenic
1055550435 9:77427870-77427892 AATTAGATCCCTAGTGGAACTGG - Intronic
1057408450 9:94794882-94794904 ACTTAGATCTACAGTGGACTTGG + Intronic
1059347067 9:113636269-113636291 ACTTGGCTCCAGTGAGGAACTGG - Intergenic
1061412432 9:130428871-130428893 CCCTGCAGCCACAGTGGAACAGG + Intronic
1188458628 X:30396402-30396424 AGTAGGATCCGCAGTTGAACAGG + Intergenic
1190317348 X:49159550-49159572 ATTTGAATCCACAGTGGGGCAGG - Intergenic
1191786797 X:64924885-64924907 ACTTTTATCCTCAGTGGAAGGGG + Intronic
1197051853 X:122068706-122068728 AATTGGGTCCACTCTGGAACTGG + Intergenic
1200699247 Y:6388083-6388105 ACTAGTAGCCACAGTGGTACTGG + Intergenic
1201034864 Y:9776615-9776637 ACTAGTAGCCACAGTGGTACTGG - Intergenic