ID: 1155021871

View in Genome Browser
Species Human (GRCh38)
Location 18:21903957-21903979
Sequence CCAGTGGGGTTTTCCCTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155021871_1155021882 6 Left 1155021871 18:21903957-21903979 CCAACTAGGGAAAACCCCACTGG No data
Right 1155021882 18:21903986-21904008 GAGGATTCTTGATCTGAAGGGGG No data
1155021871_1155021879 3 Left 1155021871 18:21903957-21903979 CCAACTAGGGAAAACCCCACTGG No data
Right 1155021879 18:21903983-21904005 CCTGAGGATTCTTGATCTGAAGG No data
1155021871_1155021880 4 Left 1155021871 18:21903957-21903979 CCAACTAGGGAAAACCCCACTGG No data
Right 1155021880 18:21903984-21904006 CTGAGGATTCTTGATCTGAAGGG No data
1155021871_1155021885 23 Left 1155021871 18:21903957-21903979 CCAACTAGGGAAAACCCCACTGG No data
Right 1155021885 18:21904003-21904025 AGGGGGCCTTTGAGATCACGGGG No data
1155021871_1155021884 22 Left 1155021871 18:21903957-21903979 CCAACTAGGGAAAACCCCACTGG No data
Right 1155021884 18:21904002-21904024 AAGGGGGCCTTTGAGATCACGGG No data
1155021871_1155021883 21 Left 1155021871 18:21903957-21903979 CCAACTAGGGAAAACCCCACTGG No data
Right 1155021883 18:21904001-21904023 GAAGGGGGCCTTTGAGATCACGG No data
1155021871_1155021881 5 Left 1155021871 18:21903957-21903979 CCAACTAGGGAAAACCCCACTGG No data
Right 1155021881 18:21903985-21904007 TGAGGATTCTTGATCTGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155021871 Original CRISPR CCAGTGGGGTTTTCCCTAGT TGG (reversed) Intergenic