ID: 1155021876

View in Genome Browser
Species Human (GRCh38)
Location 18:21903972-21903994
Sequence AGAATCCTCAGGCCGCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155021876_1155021883 6 Left 1155021876 18:21903972-21903994 CCCACTGGCGGCCTGAGGATTCT No data
Right 1155021883 18:21904001-21904023 GAAGGGGGCCTTTGAGATCACGG No data
1155021876_1155021887 26 Left 1155021876 18:21903972-21903994 CCCACTGGCGGCCTGAGGATTCT No data
Right 1155021887 18:21904021-21904043 CGGGGCCTGCCTCCTGCCTTTGG No data
1155021876_1155021885 8 Left 1155021876 18:21903972-21903994 CCCACTGGCGGCCTGAGGATTCT No data
Right 1155021885 18:21904003-21904025 AGGGGGCCTTTGAGATCACGGGG No data
1155021876_1155021884 7 Left 1155021876 18:21903972-21903994 CCCACTGGCGGCCTGAGGATTCT No data
Right 1155021884 18:21904002-21904024 AAGGGGGCCTTTGAGATCACGGG No data
1155021876_1155021881 -10 Left 1155021876 18:21903972-21903994 CCCACTGGCGGCCTGAGGATTCT No data
Right 1155021881 18:21903985-21904007 TGAGGATTCTTGATCTGAAGGGG No data
1155021876_1155021882 -9 Left 1155021876 18:21903972-21903994 CCCACTGGCGGCCTGAGGATTCT No data
Right 1155021882 18:21903986-21904008 GAGGATTCTTGATCTGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155021876 Original CRISPR AGAATCCTCAGGCCGCCAGT GGG (reversed) Intergenic