ID: 1155021878

View in Genome Browser
Species Human (GRCh38)
Location 18:21903983-21904005
Sequence CCTTCAGATCAAGAATCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155021878_1155021883 -5 Left 1155021878 18:21903983-21904005 CCTGAGGATTCTTGATCTGAAGG No data
Right 1155021883 18:21904001-21904023 GAAGGGGGCCTTTGAGATCACGG No data
1155021878_1155021889 20 Left 1155021878 18:21903983-21904005 CCTGAGGATTCTTGATCTGAAGG No data
Right 1155021889 18:21904026-21904048 CCTGCCTCCTGCCTTTGGTATGG No data
1155021878_1155021887 15 Left 1155021878 18:21903983-21904005 CCTGAGGATTCTTGATCTGAAGG No data
Right 1155021887 18:21904021-21904043 CGGGGCCTGCCTCCTGCCTTTGG No data
1155021878_1155021884 -4 Left 1155021878 18:21903983-21904005 CCTGAGGATTCTTGATCTGAAGG No data
Right 1155021884 18:21904002-21904024 AAGGGGGCCTTTGAGATCACGGG No data
1155021878_1155021885 -3 Left 1155021878 18:21903983-21904005 CCTGAGGATTCTTGATCTGAAGG No data
Right 1155021885 18:21904003-21904025 AGGGGGCCTTTGAGATCACGGGG No data
1155021878_1155021890 21 Left 1155021878 18:21903983-21904005 CCTGAGGATTCTTGATCTGAAGG No data
Right 1155021890 18:21904027-21904049 CTGCCTCCTGCCTTTGGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155021878 Original CRISPR CCTTCAGATCAAGAATCCTC AGG (reversed) Intergenic