ID: 1155021887

View in Genome Browser
Species Human (GRCh38)
Location 18:21904021-21904043
Sequence CGGGGCCTGCCTCCTGCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155021875_1155021887 27 Left 1155021875 18:21903971-21903993 CCCCACTGGCGGCCTGAGGATTC No data
Right 1155021887 18:21904021-21904043 CGGGGCCTGCCTCCTGCCTTTGG No data
1155021878_1155021887 15 Left 1155021878 18:21903983-21904005 CCTGAGGATTCTTGATCTGAAGG No data
Right 1155021887 18:21904021-21904043 CGGGGCCTGCCTCCTGCCTTTGG No data
1155021876_1155021887 26 Left 1155021876 18:21903972-21903994 CCCACTGGCGGCCTGAGGATTCT No data
Right 1155021887 18:21904021-21904043 CGGGGCCTGCCTCCTGCCTTTGG No data
1155021877_1155021887 25 Left 1155021877 18:21903973-21903995 CCACTGGCGGCCTGAGGATTCTT No data
Right 1155021887 18:21904021-21904043 CGGGGCCTGCCTCCTGCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155021887 Original CRISPR CGGGGCCTGCCTCCTGCCTT TGG Intergenic
No off target data available for this crispr