ID: 1155021889

View in Genome Browser
Species Human (GRCh38)
Location 18:21904026-21904048
Sequence CCTGCCTCCTGCCTTTGGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155021886_1155021889 -6 Left 1155021886 18:21904009-21904031 CCTTTGAGATCACGGGGCCTGCC No data
Right 1155021889 18:21904026-21904048 CCTGCCTCCTGCCTTTGGTATGG No data
1155021877_1155021889 30 Left 1155021877 18:21903973-21903995 CCACTGGCGGCCTGAGGATTCTT No data
Right 1155021889 18:21904026-21904048 CCTGCCTCCTGCCTTTGGTATGG No data
1155021878_1155021889 20 Left 1155021878 18:21903983-21904005 CCTGAGGATTCTTGATCTGAAGG No data
Right 1155021889 18:21904026-21904048 CCTGCCTCCTGCCTTTGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155021889 Original CRISPR CCTGCCTCCTGCCTTTGGTA TGG Intergenic
No off target data available for this crispr