ID: 1155026607

View in Genome Browser
Species Human (GRCh38)
Location 18:21946312-21946334
Sequence CCTTCCTTCTGGAGGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155026600_1155026607 4 Left 1155026600 18:21946285-21946307 CCTAAAATCAAGGTGTGTGCAGG No data
Right 1155026607 18:21946312-21946334 CCTTCCTTCTGGAGGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155026607 Original CRISPR CCTTCCTTCTGGAGGCTGCA GGG Intergenic
No off target data available for this crispr