ID: 1155028395

View in Genome Browser
Species Human (GRCh38)
Location 18:21962934-21962956
Sequence TCCTTGGTATGGGGCCTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155028388_1155028395 30 Left 1155028388 18:21962881-21962903 CCATATTGGACAGCACAGGTCTT No data
Right 1155028395 18:21962934-21962956 TCCTTGGTATGGGGCCTAGGAGG No data
1155028389_1155028395 -5 Left 1155028389 18:21962916-21962938 CCTCATGATGTCATGATGTCCTT No data
Right 1155028395 18:21962934-21962956 TCCTTGGTATGGGGCCTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155028395 Original CRISPR TCCTTGGTATGGGGCCTAGG AGG Intergenic
No off target data available for this crispr