ID: 1155028395 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:21962934-21962956 |
| Sequence | TCCTTGGTATGGGGCCTAGG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1155028388_1155028395 | 30 | Left | 1155028388 | 18:21962881-21962903 | CCATATTGGACAGCACAGGTCTT | No data | ||
| Right | 1155028395 | 18:21962934-21962956 | TCCTTGGTATGGGGCCTAGGAGG | No data | ||||
| 1155028389_1155028395 | -5 | Left | 1155028389 | 18:21962916-21962938 | CCTCATGATGTCATGATGTCCTT | No data | ||
| Right | 1155028395 | 18:21962934-21962956 | TCCTTGGTATGGGGCCTAGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1155028395 | Original CRISPR | TCCTTGGTATGGGGCCTAGG AGG | Intergenic | ||
| No off target data available for this crispr | |||||