ID: 1155030393

View in Genome Browser
Species Human (GRCh38)
Location 18:21978959-21978981
Sequence CGGTGACCCCCCACCCCACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155030393_1155030400 1 Left 1155030393 18:21978959-21978981 CCGGGTGGGGTGGGGGGTCACCG No data
Right 1155030400 18:21978983-21979005 CACAGGAGGGGCCATGTCACAGG No data
1155030393_1155030401 2 Left 1155030393 18:21978959-21978981 CCGGGTGGGGTGGGGGGTCACCG No data
Right 1155030401 18:21978984-21979006 ACAGGAGGGGCCATGTCACAGGG No data
1155030393_1155030406 12 Left 1155030393 18:21978959-21978981 CCGGGTGGGGTGGGGGGTCACCG No data
Right 1155030406 18:21978994-21979016 CCATGTCACAGGGCAGCTGGGGG No data
1155030393_1155030408 24 Left 1155030393 18:21978959-21978981 CCGGGTGGGGTGGGGGGTCACCG No data
Right 1155030408 18:21979006-21979028 GCAGCTGGGGGTTCCGGAGCAGG No data
1155030393_1155030403 10 Left 1155030393 18:21978959-21978981 CCGGGTGGGGTGGGGGGTCACCG No data
Right 1155030403 18:21978992-21979014 GGCCATGTCACAGGGCAGCTGGG No data
1155030393_1155030407 18 Left 1155030393 18:21978959-21978981 CCGGGTGGGGTGGGGGGTCACCG No data
Right 1155030407 18:21979000-21979022 CACAGGGCAGCTGGGGGTTCCGG No data
1155030393_1155030404 11 Left 1155030393 18:21978959-21978981 CCGGGTGGGGTGGGGGGTCACCG No data
Right 1155030404 18:21978993-21979015 GCCATGTCACAGGGCAGCTGGGG No data
1155030393_1155030402 9 Left 1155030393 18:21978959-21978981 CCGGGTGGGGTGGGGGGTCACCG No data
Right 1155030402 18:21978991-21979013 GGGCCATGTCACAGGGCAGCTGG No data
1155030393_1155030409 25 Left 1155030393 18:21978959-21978981 CCGGGTGGGGTGGGGGGTCACCG No data
Right 1155030409 18:21979007-21979029 CAGCTGGGGGTTCCGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155030393 Original CRISPR CGGTGACCCCCCACCCCACC CGG (reversed) Intergenic