ID: 1155030399

View in Genome Browser
Species Human (GRCh38)
Location 18:21978979-21979001
Sequence TGACATGGCCCCTCCTGTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155030399_1155030408 4 Left 1155030399 18:21978979-21979001 CCGGCACAGGAGGGGCCATGTCA No data
Right 1155030408 18:21979006-21979028 GCAGCTGGGGGTTCCGGAGCAGG No data
1155030399_1155030404 -9 Left 1155030399 18:21978979-21979001 CCGGCACAGGAGGGGCCATGTCA No data
Right 1155030404 18:21978993-21979015 GCCATGTCACAGGGCAGCTGGGG No data
1155030399_1155030407 -2 Left 1155030399 18:21978979-21979001 CCGGCACAGGAGGGGCCATGTCA No data
Right 1155030407 18:21979000-21979022 CACAGGGCAGCTGGGGGTTCCGG No data
1155030399_1155030406 -8 Left 1155030399 18:21978979-21979001 CCGGCACAGGAGGGGCCATGTCA No data
Right 1155030406 18:21978994-21979016 CCATGTCACAGGGCAGCTGGGGG No data
1155030399_1155030403 -10 Left 1155030399 18:21978979-21979001 CCGGCACAGGAGGGGCCATGTCA No data
Right 1155030403 18:21978992-21979014 GGCCATGTCACAGGGCAGCTGGG No data
1155030399_1155030411 20 Left 1155030399 18:21978979-21979001 CCGGCACAGGAGGGGCCATGTCA No data
Right 1155030411 18:21979022-21979044 GAGCAGGGCCGCTGTGTCCGTGG No data
1155030399_1155030409 5 Left 1155030399 18:21978979-21979001 CCGGCACAGGAGGGGCCATGTCA No data
Right 1155030409 18:21979007-21979029 CAGCTGGGGGTTCCGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155030399 Original CRISPR TGACATGGCCCCTCCTGTGC CGG (reversed) Intergenic