ID: 1155030404

View in Genome Browser
Species Human (GRCh38)
Location 18:21978993-21979015
Sequence GCCATGTCACAGGGCAGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155030393_1155030404 11 Left 1155030393 18:21978959-21978981 CCGGGTGGGGTGGGGGGTCACCG No data
Right 1155030404 18:21978993-21979015 GCCATGTCACAGGGCAGCTGGGG No data
1155030399_1155030404 -9 Left 1155030399 18:21978979-21979001 CCGGCACAGGAGGGGCCATGTCA No data
Right 1155030404 18:21978993-21979015 GCCATGTCACAGGGCAGCTGGGG No data
1155030387_1155030404 21 Left 1155030387 18:21978949-21978971 CCTGTCTGCTCCGGGTGGGGTGG No data
Right 1155030404 18:21978993-21979015 GCCATGTCACAGGGCAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155030404 Original CRISPR GCCATGTCACAGGGCAGCTG GGG Intergenic