ID: 1155030405

View in Genome Browser
Species Human (GRCh38)
Location 18:21978994-21979016
Sequence CCCCCAGCTGCCCTGTGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155030405_1155030411 5 Left 1155030405 18:21978994-21979016 CCATGTCACAGGGCAGCTGGGGG No data
Right 1155030411 18:21979022-21979044 GAGCAGGGCCGCTGTGTCCGTGG No data
1155030405_1155030409 -10 Left 1155030405 18:21978994-21979016 CCATGTCACAGGGCAGCTGGGGG No data
Right 1155030409 18:21979007-21979029 CAGCTGGGGGTTCCGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155030405 Original CRISPR CCCCCAGCTGCCCTGTGACA TGG (reversed) Intergenic