ID: 1155030405 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:21978994-21979016 |
| Sequence | CCCCCAGCTGCCCTGTGACA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1155030405_1155030411 | 5 | Left | 1155030405 | 18:21978994-21979016 | CCATGTCACAGGGCAGCTGGGGG | No data | ||
| Right | 1155030411 | 18:21979022-21979044 | GAGCAGGGCCGCTGTGTCCGTGG | No data | ||||
| 1155030405_1155030409 | -10 | Left | 1155030405 | 18:21978994-21979016 | CCATGTCACAGGGCAGCTGGGGG | No data | ||
| Right | 1155030409 | 18:21979007-21979029 | CAGCTGGGGGTTCCGGAGCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1155030405 | Original CRISPR | CCCCCAGCTGCCCTGTGACA TGG (reversed) | Intergenic | ||