ID: 1155030406

View in Genome Browser
Species Human (GRCh38)
Location 18:21978994-21979016
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155030393_1155030406 12 Left 1155030393 18:21978959-21978981 CCGGGTGGGGTGGGGGGTCACCG No data
Right 1155030406 18:21978994-21979016 CCATGTCACAGGGCAGCTGGGGG No data
1155030387_1155030406 22 Left 1155030387 18:21978949-21978971 CCTGTCTGCTCCGGGTGGGGTGG No data
Right 1155030406 18:21978994-21979016 CCATGTCACAGGGCAGCTGGGGG No data
1155030399_1155030406 -8 Left 1155030399 18:21978979-21979001 CCGGCACAGGAGGGGCCATGTCA No data
Right 1155030406 18:21978994-21979016 CCATGTCACAGGGCAGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155030406 Original CRISPR CCATGTCACAGGGCAGCTGG GGG Intergenic