ID: 1155030407

View in Genome Browser
Species Human (GRCh38)
Location 18:21979000-21979022
Sequence CACAGGGCAGCTGGGGGTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155030387_1155030407 28 Left 1155030387 18:21978949-21978971 CCTGTCTGCTCCGGGTGGGGTGG No data
Right 1155030407 18:21979000-21979022 CACAGGGCAGCTGGGGGTTCCGG No data
1155030399_1155030407 -2 Left 1155030399 18:21978979-21979001 CCGGCACAGGAGGGGCCATGTCA No data
Right 1155030407 18:21979000-21979022 CACAGGGCAGCTGGGGGTTCCGG No data
1155030393_1155030407 18 Left 1155030393 18:21978959-21978981 CCGGGTGGGGTGGGGGGTCACCG No data
Right 1155030407 18:21979000-21979022 CACAGGGCAGCTGGGGGTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155030407 Original CRISPR CACAGGGCAGCTGGGGGTTC CGG Intergenic