ID: 1155030408

View in Genome Browser
Species Human (GRCh38)
Location 18:21979006-21979028
Sequence GCAGCTGGGGGTTCCGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155030393_1155030408 24 Left 1155030393 18:21978959-21978981 CCGGGTGGGGTGGGGGGTCACCG No data
Right 1155030408 18:21979006-21979028 GCAGCTGGGGGTTCCGGAGCAGG No data
1155030399_1155030408 4 Left 1155030399 18:21978979-21979001 CCGGCACAGGAGGGGCCATGTCA No data
Right 1155030408 18:21979006-21979028 GCAGCTGGGGGTTCCGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155030408 Original CRISPR GCAGCTGGGGGTTCCGGAGC AGG Intergenic