ID: 1155030411

View in Genome Browser
Species Human (GRCh38)
Location 18:21979022-21979044
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155030399_1155030411 20 Left 1155030399 18:21978979-21979001 CCGGCACAGGAGGGGCCATGTCA No data
Right 1155030411 18:21979022-21979044 GAGCAGGGCCGCTGTGTCCGTGG No data
1155030405_1155030411 5 Left 1155030405 18:21978994-21979016 CCATGTCACAGGGCAGCTGGGGG No data
Right 1155030411 18:21979022-21979044 GAGCAGGGCCGCTGTGTCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155030411 Original CRISPR GAGCAGGGCCGCTGTGTCCG TGG Intergenic