ID: 1155030735

View in Genome Browser
Species Human (GRCh38)
Location 18:21981364-21981386
Sequence TCCAGAAGAGGGAGAGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155030735_1155030740 -5 Left 1155030735 18:21981364-21981386 CCTGTCCCTCTCCCTCTTCTGGA No data
Right 1155030740 18:21981382-21981404 CTGGATGTTACAGATTTTCCTGG No data
1155030735_1155030741 11 Left 1155030735 18:21981364-21981386 CCTGTCCCTCTCCCTCTTCTGGA No data
Right 1155030741 18:21981398-21981420 TTCCTGGAAAATATTTTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155030735 Original CRISPR TCCAGAAGAGGGAGAGGGAC AGG (reversed) Intergenic
No off target data available for this crispr