ID: 1155030740

View in Genome Browser
Species Human (GRCh38)
Location 18:21981382-21981404
Sequence CTGGATGTTACAGATTTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155030735_1155030740 -5 Left 1155030735 18:21981364-21981386 CCTGTCCCTCTCCCTCTTCTGGA No data
Right 1155030740 18:21981382-21981404 CTGGATGTTACAGATTTTCCTGG No data
1155030736_1155030740 -10 Left 1155030736 18:21981369-21981391 CCCTCTCCCTCTTCTGGATGTTA No data
Right 1155030740 18:21981382-21981404 CTGGATGTTACAGATTTTCCTGG No data
1155030733_1155030740 -4 Left 1155030733 18:21981363-21981385 CCCTGTCCCTCTCCCTCTTCTGG No data
Right 1155030740 18:21981382-21981404 CTGGATGTTACAGATTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155030740 Original CRISPR CTGGATGTTACAGATTTTCC TGG Intergenic
No off target data available for this crispr