ID: 1155035809

View in Genome Browser
Species Human (GRCh38)
Location 18:22023953-22023975
Sequence ACACCCTGCCAGGCTACAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155035807_1155035809 -7 Left 1155035807 18:22023937-22023959 CCTGGGCAACAGAGCGACACCCT 0: 17
1: 1164
2: 17730
3: 75104
4: 195164
Right 1155035809 18:22023953-22023975 ACACCCTGCCAGGCTACAACAGG No data
1155035806_1155035809 -3 Left 1155035806 18:22023933-22023955 CCAGCCTGGGCAACAGAGCGACA 0: 156
1: 15618
2: 97399
3: 183419
4: 277312
Right 1155035809 18:22023953-22023975 ACACCCTGCCAGGCTACAACAGG No data
1155035805_1155035809 7 Left 1155035805 18:22023923-22023945 CCACTGCACTCCAGCCTGGGCAA 0: 66497
1: 175004
2: 225621
3: 191618
4: 110379
Right 1155035809 18:22023953-22023975 ACACCCTGCCAGGCTACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155035809 Original CRISPR ACACCCTGCCAGGCTACAAC AGG Intergenic
No off target data available for this crispr