ID: 1155037747

View in Genome Browser
Species Human (GRCh38)
Location 18:22039509-22039531
Sequence TGTTCCAAGGCCCCCAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155037747_1155037753 26 Left 1155037747 18:22039509-22039531 CCCACTTTGGGGGCCTTGGAACA No data
Right 1155037753 18:22039558-22039580 GATATGGCTGAAGCTTTTGGTGG No data
1155037747_1155037750 -2 Left 1155037747 18:22039509-22039531 CCCACTTTGGGGGCCTTGGAACA No data
Right 1155037750 18:22039530-22039552 CAAGCATTTGCAGCTCTTTCTGG No data
1155037747_1155037754 27 Left 1155037747 18:22039509-22039531 CCCACTTTGGGGGCCTTGGAACA No data
Right 1155037754 18:22039559-22039581 ATATGGCTGAAGCTTTTGGTGGG No data
1155037747_1155037752 23 Left 1155037747 18:22039509-22039531 CCCACTTTGGGGGCCTTGGAACA No data
Right 1155037752 18:22039555-22039577 AAAGATATGGCTGAAGCTTTTGG No data
1155037747_1155037751 10 Left 1155037747 18:22039509-22039531 CCCACTTTGGGGGCCTTGGAACA No data
Right 1155037751 18:22039542-22039564 GCTCTTTCTGGTGAAAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155037747 Original CRISPR TGTTCCAAGGCCCCCAAAGT GGG (reversed) Intergenic
No off target data available for this crispr