ID: 1155042492

View in Genome Browser
Species Human (GRCh38)
Location 18:22076288-22076310
Sequence CCATGAGGGGCCAGTCTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155042492_1155042496 -10 Left 1155042492 18:22076288-22076310 CCACTGAGACTGGCCCCTCATGG No data
Right 1155042496 18:22076301-22076323 CCCCTCATGGGAGCTCTTTATGG No data
1155042492_1155042499 -3 Left 1155042492 18:22076288-22076310 CCACTGAGACTGGCCCCTCATGG No data
Right 1155042499 18:22076308-22076330 TGGGAGCTCTTTATGGTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155042492 Original CRISPR CCATGAGGGGCCAGTCTCAG TGG (reversed) Intergenic
No off target data available for this crispr