ID: 1155043675

View in Genome Browser
Species Human (GRCh38)
Location 18:22085710-22085732
Sequence TGGCTTCCAAACATACAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155043665_1155043675 21 Left 1155043665 18:22085666-22085688 CCTCCCCAGCTCCGTCTTCCTTA No data
Right 1155043675 18:22085710-22085732 TGGCTTCCAAACATACAGCCTGG No data
1155043670_1155043675 3 Left 1155043670 18:22085684-22085706 CCTTACTCTCTTTGCTCAGTCCC No data
Right 1155043675 18:22085710-22085732 TGGCTTCCAAACATACAGCCTGG No data
1155043668_1155043675 16 Left 1155043668 18:22085671-22085693 CCAGCTCCGTCTTCCTTACTCTC No data
Right 1155043675 18:22085710-22085732 TGGCTTCCAAACATACAGCCTGG No data
1155043663_1155043675 28 Left 1155043663 18:22085659-22085681 CCAGAGCCCTCCCCAGCTCCGTC No data
Right 1155043675 18:22085710-22085732 TGGCTTCCAAACATACAGCCTGG No data
1155043667_1155043675 17 Left 1155043667 18:22085670-22085692 CCCAGCTCCGTCTTCCTTACTCT No data
Right 1155043675 18:22085710-22085732 TGGCTTCCAAACATACAGCCTGG No data
1155043669_1155043675 10 Left 1155043669 18:22085677-22085699 CCGTCTTCCTTACTCTCTTTGCT No data
Right 1155043675 18:22085710-22085732 TGGCTTCCAAACATACAGCCTGG No data
1155043666_1155043675 18 Left 1155043666 18:22085669-22085691 CCCCAGCTCCGTCTTCCTTACTC No data
Right 1155043675 18:22085710-22085732 TGGCTTCCAAACATACAGCCTGG No data
1155043664_1155043675 22 Left 1155043664 18:22085665-22085687 CCCTCCCCAGCTCCGTCTTCCTT No data
Right 1155043675 18:22085710-22085732 TGGCTTCCAAACATACAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155043675 Original CRISPR TGGCTTCCAAACATACAGCC TGG Intergenic
No off target data available for this crispr