ID: 1155046249

View in Genome Browser
Species Human (GRCh38)
Location 18:22105959-22105981
Sequence ATGTGAAAGGGGAGAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155046249_1155046254 25 Left 1155046249 18:22105959-22105981 CCTTCCACTCTCCCCTTTCACAT No data
Right 1155046254 18:22106007-22106029 CATCTTTGAACCTTCTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155046249 Original CRISPR ATGTGAAAGGGGAGAGTGGA AGG (reversed) Intergenic
No off target data available for this crispr