ID: 1155047346

View in Genome Browser
Species Human (GRCh38)
Location 18:22114367-22114389
Sequence TTCTGTTTCCAGTTCATCAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155047346_1155047347 23 Left 1155047346 18:22114367-22114389 CCGTTGATGAACTGGAAACAGAA No data
Right 1155047347 18:22114413-22114435 TCTTTCTGACGCCAAACTCCAGG No data
1155047346_1155047348 24 Left 1155047346 18:22114367-22114389 CCGTTGATGAACTGGAAACAGAA No data
Right 1155047348 18:22114414-22114436 CTTTCTGACGCCAAACTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155047346 Original CRISPR TTCTGTTTCCAGTTCATCAA CGG (reversed) Intergenic
No off target data available for this crispr