ID: 1155050814

View in Genome Browser
Species Human (GRCh38)
Location 18:22146345-22146367
Sequence TCACTCCAGTTTAAAACTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155050814_1155050817 8 Left 1155050814 18:22146345-22146367 CCTAAAGTTTTAAACTGGAGTGA No data
Right 1155050817 18:22146376-22146398 GTAGCTGGGATTTGAGACAGAGG No data
1155050814_1155050823 29 Left 1155050814 18:22146345-22146367 CCTAAAGTTTTAAACTGGAGTGA No data
Right 1155050823 18:22146397-22146419 GGGTGGGTGTCTGTGATCTGGGG No data
1155050814_1155050822 28 Left 1155050814 18:22146345-22146367 CCTAAAGTTTTAAACTGGAGTGA No data
Right 1155050822 18:22146396-22146418 AGGGTGGGTGTCTGTGATCTGGG No data
1155050814_1155050820 13 Left 1155050814 18:22146345-22146367 CCTAAAGTTTTAAACTGGAGTGA No data
Right 1155050820 18:22146381-22146403 TGGGATTTGAGACAGAGGGTGGG No data
1155050814_1155050818 9 Left 1155050814 18:22146345-22146367 CCTAAAGTTTTAAACTGGAGTGA No data
Right 1155050818 18:22146377-22146399 TAGCTGGGATTTGAGACAGAGGG No data
1155050814_1155050819 12 Left 1155050814 18:22146345-22146367 CCTAAAGTTTTAAACTGGAGTGA No data
Right 1155050819 18:22146380-22146402 CTGGGATTTGAGACAGAGGGTGG No data
1155050814_1155050815 -7 Left 1155050814 18:22146345-22146367 CCTAAAGTTTTAAACTGGAGTGA No data
Right 1155050815 18:22146361-22146383 GGAGTGAAAGTCTACGTAGCTGG No data
1155050814_1155050821 27 Left 1155050814 18:22146345-22146367 CCTAAAGTTTTAAACTGGAGTGA No data
Right 1155050821 18:22146395-22146417 GAGGGTGGGTGTCTGTGATCTGG No data
1155050814_1155050816 -6 Left 1155050814 18:22146345-22146367 CCTAAAGTTTTAAACTGGAGTGA No data
Right 1155050816 18:22146362-22146384 GAGTGAAAGTCTACGTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155050814 Original CRISPR TCACTCCAGTTTAAAACTTT AGG (reversed) Intergenic
No off target data available for this crispr