ID: 1155051947

View in Genome Browser
Species Human (GRCh38)
Location 18:22156269-22156291
Sequence GATTTTTTTGCAATTAAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155051947_1155051952 0 Left 1155051947 18:22156269-22156291 CCCCCCTTAATTGCAAAAAAATC No data
Right 1155051952 18:22156292-22156314 TGAGAAATGTAGTTTTTAGCTGG No data
1155051947_1155051953 1 Left 1155051947 18:22156269-22156291 CCCCCCTTAATTGCAAAAAAATC No data
Right 1155051953 18:22156293-22156315 GAGAAATGTAGTTTTTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155051947 Original CRISPR GATTTTTTTGCAATTAAGGG GGG (reversed) Intergenic
No off target data available for this crispr